Login

ID :
PASSWORD :
E-mail : chowhan@seeders.co.kr

Home > MAB      


Information

Crossbreeding combination : 146 X     Marker selection method (distance) :
Search

MAB viewer     Marker(#) : 180


MAB marker Information     Marker(#) : 180

Chr. No. SNP position Ref Perennial Dempsey Left Right Sequence Primer Size TM Product Size Detail info
chr01 1,773 G G A
CACTTTGAGGCCATCACCCA
CGTCGTGATGAGGAGAGTCG
20
20
20
59.97
137
AGGATAACACCCGAGAAATAGCGATCATATATCGAGTATATTATCGCCTCATGGGTACTACCCTAGCTCCAAAAGCTAGATTCACGAGCCCAAAAGGGGT
TACCACCCTAATGGAAGCTAACAAAGACCGAAGCACAGTCTTTGTTCCAAAGGCTCTAGTGTGGGATGATATCCTACACAGTAATGACTGGCACTTTGAG
GCCATCACCCAACCTATTCGGAGCTACTCCGAAAGATCTCAGATCGAACGGGTTATCCAACACCCAGATGGATCTATAGATCTGAAATTTTTAGGGGTC[
G/A]ATCCTTCTCGACTCTCCTCATCACGACGGTCTGTATCCTCAAAAGCCTCCTCCTCTAAAAAGGAACGAGACATTGATGATCCCAACGGCCCCGACG
ATAAGGGAAAGATTAGAGGAGTAGACTACTCGGGTCCTATCCCGAAAGTCTATTACCAAACCCCTCAGGTCAAGGAACCTGAAAATCTTTACGAACCAGG
AAGCCCTTCGGCCTCCGAAATGGCTCCCCCTCAACAACCTCGGCGCGACCCTAGCCTTTTTGTTATTCGCGCAGATAACGAAGAGTATATCCCGGATCTT
CAGG

chr01 9,000,156 A A G
ACGAAGCGCATGACAGAGAA
AGTTCCAAGACCATGAAGCCT
20
21
20
59.29
89
TTTGAACAAACCACATGTTAACTAAGGCCAGCTTTCCTTACATATTCACTGAAAACCTGTTTAAAGTTCTTTTTCTATTGTCTATGGTATTAGAGTAGCT
GAGATCTCTCATCAACATAAATTACTAAACTCAAATATGCGAAAACAAATCACTCATATTTTCGTTTTGAGCATTTAAGACCATTTTCATCAATTCAAAT
TGTAGAAGGCCCTTATTTCAGCTTCTGGTCGAGGTGACAATCCAGAGGTAGAACTGGAAAACGAAGCGCATGACAGAGAAATACATATATAAACGTCAA[
A/G]TCTTAAGATAAATTTCTTGTGGCCAGTTAGGCTTCATGGTCTTGGAACTCTTTTATTAAAGAGTTCTGACTATTCTCCCTCCAAATACCATTCACT
CAACTACAGTGAAGTTCAATACGGGTAACAGAAATTACGGGATACCATTAACAGTAAATCCAGACTGGGGTTAAACAAGCATCGGATAACGCAGAACAAA
GGAATAGAGAACGGAGATTGAAGAGAAACTAAAGTTCCACTTTGAATATCCCACAAGCAACTTTCTTATCAAATGTTAAGAAGCTTCAAAAGATAGAAAG
GCTA

chr01 19,500,398 G A G
GGAGTTGTGTGTTTGACAAGTGT
TGCGTTCATCATATCGATCCT
23
21
23
57.06
150
TTCTTTCAAAATTAAGGCCATTATTTTGAGACTCACGAGAATAACTAGGTCATCAAAAGAAAAATATGTCTCAATTAGGTCAAATAATAGACGTGTGATC
CCTATATCAAGAGGAACAGAAAGAAAATTAACTCCACGAAAGCATGAGTCATTCGATGTGAGGGATGTACCACAAATGTGGAGTTGTGTGTTTGACAAGT
GTAGAAGAAGAAGTGGCACACATGCTCAATTAAAGTTAGTGTTGTTAAAGTGTCACAAATGATCTTCATCTTTCACTTCATATTGCATGATGTGTACTT[
G/A]TATTTTCAAGGATCGATATGATGAACGCATTTCATTCTGCTATCCAAACATTGTGTCATCCTTTATTTACCCTATTTGAGCCTTAGTTTTATTTTC
TTTCATGTACTTTTTTGGAATCAAGATAGATTCAGTAAAGCTCAAAACAAAGTGTCAAGCAAAATAATAGAGTCAGAAAATTTCTAAAAAAACAAGGAAA
CGAAAAATATGTCCAAAAAGAAAGAAAAGAGAAGAATATCAAGAAAAATAGAGTCAAAAAAAGTTTCAAAAAGAAAAAAAGTCAATAAAAGAGAAAAAAG
AAGA

chr01 64,502,442 G T G
TGAGCTGACTTGCTAGGACA
CCAGCAAGATCCTTGTTAGCC
20
21
20
58.98
129
GATGACTTGGTGGCTTTAAGGAAAAATGCTAAAGCTAAGAACATTCTAGCCTGTGGATTAGGACCCATTGAATATAACAGCGTGTCGACTTACATCACTG
CTAAGCAAATTTGGGATGCATTGGTAAATGCATATGAGGGTACTTTTCAGGTAAGACAATTTAGAATTTCCCTTATCTTTACTAAGTATGAGGCTTTCAA
GATGAAGGAAAATAAATCCCTACATGAGATGATGACAAGGTTTACAACCTTAACAAATGAGCTGACTTGCTAGGACAAATTCATCACTGAGGAGGAACA[
G/T]GTTGAAAAGGTTCTACGGGTATTACCAAAAACAAAATGGAATATTAAGGTAACTGCAATTAGGGAGGCTAACAAGGATCTTGCTGGAATGACTTTT
GATGAAATAGTTAGAAATTTAAGAACATATGAAATGGAAGTTGATGGAACCAAAGAACAATAAGTTCCAGAGAAAATCCTGGAATTGAAGGCTTCTGAGA
GTGATGATGAATTTGAACTTATTAAGGAATAAGTCGCCTTCATAACCAAGAATTTCAGTAACTTCTTAAAATAAAAGGGAACAAGTAGCAAGAAGAGTTT
GAAT

chr01 74,000,335 C T C
TCAACTCTTGTGGCGCTGAT
ACGCTGAAGAGGAAGCAGTC
20
20
20
60.04
139
TGTGTTTTGAATTCAACAATTTTGTCCCTTAGGACTATTGATTTTGATTTTCCTTTGGTCATAAGGATCAGTGTGTATCCATGTTTAGTACCTTGTAATT
TTCCTCATATTTATTTTTAAGGATGTGATACACGGCCTTCATCCTAAAGCTCTCCTGGTTTGGATTCATTTTTTATCAAAAATATGGAATCATTTTATCA
ACTCTTGTGGCGCTGATATTAAAGTCACTTAATTTTTTCACTGTTATATAATTAAAAGTGGAAAAATATAATTGATCATCTTGAGATTCCATTGCTATG[
C/T]TGTAGAATCTACAATAGACTGCTTCCTCTTCAGCGTAATTTCTTATTGAACTAGTCAAATGTATTGGTAGTCCTTCTAGTTCAGATAGATTTGATT
TGGAATAAACACGATTTAAGTAACCGAATTCAAATAATTTGGCTCTGAAATCAACCAATCCTCCCAGGAATATAGAAATCCTTGGATATAGGCTCTTCAT
TTCAATAACTCCAAAAGTTTTTCCACAGGTTTCTGGGAGATTGTATATTCTCTTTGTGGAAGTTATATATTCTTCTTTCATCGAATGAATTTTTTCTACC
TGAA

chr01 76,500,299 C G C
TCCTGGTCACGTTCCTCTTC
TGGCATACCAGGGACTCTGA
20
20
20
59.96
92
AGCAGCTTCACAATTTCCAGGAGAGACATACAAACAGCTCCTATCATTCTTATTCTTCCAATTTCTTTGGTCTCGGTCCTTGTATTCAAAATTTTCATAA
TTGTTAGACCTTGGTTTCCTTGGCCACTGCCTCAGAAACCCCCATGATTATTCAAGTAATTTATGTCCTCTTCAGAATCGAAATTAGCTCTTCCCTGTGA
TACAACAGCTTTGACCTTTTCTATCTTCCCCGATAATAACAGCTACAACAGCGTTTTCATATGAGCCATATCCTGGTCACGTTCCTCTTCTCTTTGCCT[
C/G]TGTTCTACCGTCATTCCAATAGATATAGTAGAGCTTACTACCTCAGAGTCCCTGGTATGCCAAGCTCTACTTTACTTTGTCATACGATCCAGCATG
TCAGATGCTTCAAGAAAAGTAAGGTCCAAGAATGAACCACTGGTAGTATTATCTACCACTGGCTTAGTCACAGAGTTCAAAGCCCTATATAATATCTCCA
TCAAGTAAACATTAGTCATCTGATAATTTGGGCACCACATAAGATTCTTCTTGAACCTCTCCCAAGTCTCGTGGAGAGCTTCAGTTGGAAGCTGTCTAAA
ATTG

chr01 112,694,926 T T C
CCCTACAATGGGTTGATGTCTCA
ACCAAGACTCATTGCAACTTCA
23
22
23
58.45
92
GAATTACATTGAGATGAGATTTTATATGTTTTAACATGAATTGGAAATATAGTTTTATATCTTATATTATTGTCCATGAGCTAAGGGATTATGTCATCCG
ATATGTGTATGATGTTGAGATGGAATTATGTCCAAAAAGTATTTGATTATGAGAGTATGATGATTTAATTTGTTAAGCCTTGATTTATAATATCATTCCA
CTATTTCCTTATTATAAATTTATAATTGATATTGGAAATTCTTATCCCTACAATGGGTTGATGTCTCAAGTACCTTTAAATGAGAGTTGGATGGAAAAT[
T/C]GAGAAATGTTGATATTGAAGTTGCAATGAGTCTTGGTATTTTTTGGATGGTTTTGATGAGTTAAATTGTTGAAAATATTATGTATTGAGTCTTCAT
ATCATTGTCCAAATGTTGAGTCAGTTATGGTTCAATGCATTGATACCTTGTTGATGTTGAGGAAGATTAAAATGTTTTGAGCTAAAATGTGTTGAGTTAG
GAATCCACAAATTGATATGATTTAATAAATGAGAAAGAGATTTGATTTGGTCTTTATGGTACACCCTTGTGATGTTGTAGTGGATTTTCTAACACGTTCT
GAGC

chr01 122,001,768 C T C
GGTGCTCAACCTAACCTATTGGA
CGAGACTGTAAGCACCGTGT
23
20
23
60.04
148
CTAAAATAGAATCTGGCGTAATCATCGGCAGAATATGTAGTGTTAACTGGTAGGAAATGTGCTGAATTAGTAATTTGGTCAACAATAAGCCAAATTGAAT
CATGCTATCAGCGAGTATGAGGTGACCCTATAATAAAGTTCTTATTCACCTCTTCTCACTTCTAAGTAGGAATACAGTCATATCTAGTCTTTGGTGCTCA
ACCTAACCTATTGGAATTTAGACACTGCCATAAATTCCATAATATTATTCTTTATTTTATTCCACCAATAGACTTCTTATAGGTTACAATTGTAATGAC[
C/T]CGAGACTACCCCCTGTCATCACACGGTGCTTACAGTCTCGAGGGACCACAAGTTAACCCATGAGCTAGTACCTGTTGTGAGTACTGAATAATAATA
TCATAATTATGGAAAACATTTGATATTGCCATAAGTTTTTATCACTGAATCAATACTGAAATATAAATCTATAGAAAAACTGACTGAATTTGATTAAATA
CTGATAAACTGACATGTCAACTGATCATTCGAATACTAAATAATTGATTCTAATGTCTAAAAAACCTTTAAAGCTAAATAACTGAATAAAAGTTGATGGG
ACAG

chr01 144,002,319 C A C
AGGAATTTGGATGAGGCGCA
ACACCATGCACTTAGCCACA
20
20
20
59.89
139
CATCTCTTGGACTCCAAAGATGGTAGTGTGGTGGTGCAAGAAGTGGTTCTATCATCCCTTGATGCAGAGATTAAGTAGAAGCAAGTGCTTGATCCTATCT
TGATGAAAATTAAGAGTGATGTTGGTGGGAAGGAGGTAGTGATGTTTGAGATCAGTGGCGACGGTACTTTATGGTATCAAGAAAAGTTGTGTGTTCCTGA
TATCGATGGATTGTGACAAAGGAATTTGGATGAGGCGCATTAGTCATGCTATGTTGCTCATCCCAAATTAATATAGATGTATCATAATCTCAAAAATAT[
C/A]TATTGGTGGAATGGCATAAAGAAATATGTGGCTGATTTTGTGGCTAAGTGCATGGTGTGTCAATAGGTTAAGGTTGAGCACATGAGGCCAGGAGGG
TTGTATCAAGAAATTGATTTGGCCAAGTAGAAATAGGAAGTGATCAATATGGACTTTGTTGTCAGTCTTCCTCGATCTTGCAATTAATATGATTCGATTA
GGGTCATCGCGGATAGGATTACTAAGTTCGTACACTTTTTACAATTGTAGACTACCTACTCGGTGAAGGACTATGCAAAGCTGTATCTTTAGGAGATTTT
GAAG

chr01 163,504,656 G G A
CTCTCCAACCCCACGATGTG
TTCCTTTGTCTTTTTATTTGACCA
20
24
20
55.38
148
TGGTGTTGTGTGATGTCTATGATTTCAGTTAGATAGTTCTTATTTTTATCTTGTGGTTGTATTATTATCTTGTTGCTAGCGGTGTTAGTTTATTTTGTAC
TTATCTTTTGAGTTTGTTATACTGTTATTGGTTCTAAGCTGGGGGTCTATCGAAAACAACCTCTCTACTTCACCTGAGGTAGTGGTATGACCTGCGTGCA
CTCTACCCTCTCCAACCCCACGATGTGGGAATACACTGGGTATGTTGTTGCTGTATTAGAAGTTTCGAATACTTTGAATAATTAGTTAATTCATAATTG[
G/A]ATGAGTCAAAATTCCAATTTATTTACTTATATGGTCAAATAAAAAGACAAAGGAATTTAAATAGGTGAAATTGACTAATAATAATAATCACAACTT
CGAATATTAGGATAAAAAGGGAGGTAGAAATTTTTAACGGAGAAATAAGTTGTGAGTCAATGAGTTTCAGGTAAATACTCTGACTTTAGAAATTTGTGTG
ATTTGACATGGTGTAATTATTGAATAATAGGTAATGAAAGTAGTAATGATTATGTAATCATTACACTTAGAACAAATGATTTGCCAATCCTTTGCGTAAT
CACT

chr01 191,003,116 G G A
CCCTCACCTTCTTGGATGGT
CTCACCCCTCTTCACCCTTA
20
20
20
58.05
150
TGCATATGCATATCTGTCATACTTTTAAAGTCTTAGGCGAAAAAGGTATGGATGGGGTAATATTGTGCACCTTGCTTGGCCCGTCGCAAATCCCTCTTTT
CTTTAGTGCCAAGTTCCACATTTATGTCCACCTTCTTGAATGACCCCTTAACTTTAACAATTTTTGAAGAGGAAGGAGTTGTAATTTTTTTGGACTTCTG
ATTGGAGAGTACTTGGCTAATTGCTCTTTTCTTCCTCCCAACCATCACTGTATAAGTTTATGGCTCCCTCACCTTCTTGGATGGTATGACACTCCTCTT[
G/A]GATTTTAATTCCTCAATAGCTTTAACGATAGCCTCTACTTTTTCAAAGAGTTTATCCTGGCATTCCTTACACTTTTCTCATTTGCAATAAGAATAT
AAGGGTGAAGAGGGGTGAGAGGGGCCGGTGTAAGGGTGAGAGGGACCTGTGTAAGGGTGTGAGGGACCTGTGAAAGGGGTGTTTTCAAACATATTTATTT
TTTCTTAAGCATTAACATAATCAATATCACGACTGGCAGTAGCATCAACATACCTACCACCAACATCAACTCCACCAGCAACACCCCCAGAAGAAGCACC
TAGA

chr01 201,000,033 C C T
GCCTCTAACCTCCCAGCATA
TCTGTAACATGGCAGTGGAG
20
20
20
57.23
150
ATAGGGAACAAGGCTTAGCATGCACGTAAAACCATTAACTTGGACTGTGTAGCATAACCATCATTATAAGTCACCCACGAGCTATATGGATCCAGCTTTT
CCATAGCTGAAAGGGCCTCAGTGTATGTGGCCGCACAAAATACAGAATAATTACATATACATATGTACTATTGGGGCCTCTAACCTCCCAGCATATATCA
AGAGTGACTTTGACACTCAATCATATAACACGGGAGACTCAAATCTTCTGGTTATTTAGATCCCTACGTCGATAACAATGGTTTCCAGTATTAGTCCCT[
C/T]GGGACCTCCACTGCCATGTTACAGATACACAACCCTCATTAAAACCCAATTAAAAGACTTTTCACACATTCACAATCATAAAAAAAAAGTCATTCA
CTAAGGCATCATCAAGTGGTATCGTCATACCGACTATAGCTTGCAAATGCAGTCACTTTGCCAAAATAATCAATCTTCCAATGGGACTCTAACCCAATTA
GCCATCACGACTCCAAAGTTCCACATAGGAAACCAGCCACATAGCCAAGTGGGACTCTAACCCCTTTAACTGATGGGAATTCAAAGTTCTAAGTAGGAAC
AAAA

chr01 222,504,425 C T C
GTTGACACGCCACGATATGC
GGGTGGATCCGAGCATGTAG
20
20
20
59.97
114
TTGAAGAAAAAGTTATGGCCAACAAGGATATCGAGTTTGTTTTCACTAATCATATAGGGAGTTCAGGGAATGAGAATTTAGGAGCTAATGAAGAGATTCG
AAAATTAAGGCAGCAAATGATAGAAATGCAGCGAGGTTGGGCTAACGGGTAGCCACCTCCTCCATTTTCTGCTGATAATCTGGAATATCTTTCTGGCTTG
CCTCTAGTGTCACATGCACAATTTTCCATTTTTGTTGACACGCCACGATATGCATCAGGGACTACTCTGAGGCAACACTATCCAAACATTTCCAATATT[
C/T]ATTTCCTCACTCTTCAACACTAAACTACTACATGCTCGGATCCACCCACTGTTCATGTTTTTTCAGTACCACCCCCACTCGAAGCTCCTACTTTTG
AGGTTTATCCACTTGTTATGCCTCCCCACTCTGCGAGAGAGCCTATATTGAATATTTCTGTTGATCAGCATCATGCTATTCTGCCCACATTTAAGTTGAC
TGATCCTTATAGCTACACTCGCACGCCTGAATTTCCTCTTAACACTAAGAAGCCTGCTATAACAGAAGAACAAGAAGAAATGACCAGAAAATTGAGAAGT
TTGG

chr01 229,000,170 A A G
AGTGTCCCGTTAAAATTTGGT
TTACTCGTCAAGGTACGCCG
21
20
21
59.83
130
TATAACGAACACATACCAATTTATTTTTTATACATTTATAATTATTGACGTTATATACACGTTCAAAGCACGTACATTAAACTAGTATATATTAAAAGTG
TGAAAACCCTTATAAAAGTGATTTGAACTTTTTGTCCTTCATTAAAAGACTTTGTATAGACAAAACTGCCATTTACAATTTTACTACATTATTATTTAAT
TATTTTGTAACATTTTAAGTGTCCCGTTAAAATTTGGTTATTAAATTTTTCCTTACTAACCAAGTTCTACTTTAGTAATTATTGTTCTGTCACGATCCA[
A/G]AAATAAGGGTCATGATGACACTTGTCGCGGCGTACCTTGACGAGTAAGCCTATTACCCAAACTGATACAAAAAGAGGAACAGACAAAAATATCCCA
AGGTAAAGCTTCTAGAATGAAGCCGAACCATATAAGTAATCATAACAATGCGAAAAGAACTTATTCAAAATATCAATCATGCCCAAAACCAGGTGTCAAT
AGTGTAAGAACTACTAATACAATCCAAGAGTCAAATACATTGAAAAAATAAACATAAAGGAATAATATCTGTCTCCGAATACTAATAAAGACATAACTAC
TATA

chr01 245,710,298 A A G
TGACACCCCATAGTTGTAAAGCT
ACACCACCAACATCTCTCACA
23
21
23
59.23
107
GTATAAAAGTTTTGGCGAAATGTGCTTCATTCTATCTCCTTTTGTGAATCCTCCCTTTAGTTATGCTATGCATGATGCATTATCTTCATGTAAAATCATG
GATACTGTAACACCCTGCACTTTTGGGCTAAAGTCGAATTGTCTTCCCGATGTATATAGACCCGAACCCAATGATTTCTAGTTAGAAATAAGTGTGATTA
ATATTTTCTTAGTGTGGGAATATCCTTGGAGATGAATATTGTGACACCCCATAGTTGTAAAGCTCTATTAAGGCATTTAAGATGACCTTTAGGACCCCC[
A/G]TAGTGGTGGTAGATCATGTGTAGACGTTGTGAGAGATGTTGGTGGTGTTTTAGGACCTTAAAACTTAATGTACGTTGCAAGATAGGACCTATGCGA
TGGCCGTGCATTGCATTACGATCGCCTACCATCACTGGAGAAGCTAGGCGATGGCCTAGGAGTTGCCCAGCTGGGAGATAGGCCATAAGCTACGCGCTGC
CCATTTTGGGGCTAGGCCATGAGCTAGGCGTCTCCCACATGGTGGCTAGGCTATGGGTTGTGCGCCGCATAGCCAATGCATAGAGGCATAGGGACTCTAT
TTTT

chr02 6,000,088 T T C
ACCCTTGAATTTGCAATTGAGT
GCATTTTAGCAAACACTTGGGG
22
22
22
58.93
98
ACAAACTCAAAAATTCCTCCAAGAACCTTTAAGAGCTAATCTTCTCAGGTATGTTAGGTGTTCATTCATGGGTTCCTTTCACCTATGAAGTCAAAGAATC
ACTTTTAAACTTACAAGTTCTCAGATTTATGAATTTCATGCTTGAAATTGATTGTATTCATGTTTGTGGTAGTAATCGGGTCTCAATTCATGAGTAATTA
TATGTTTTTATGAAATTAAAAATAGTTTATATGATGAATTATATGAATTGCATGATAAACCCTTGAATTTGCAATTGAGTATTGTATTCATGATGTTCA[
T/C]ATGTTGGCTATTATCATGTAAGATAATCCCTACCCCCCAAGTGTTTGCTAAAATGCCTATGTGAAGTAAATAGTGGAATCATGACATGTCATTATG
TGGTCCCAATCATGTACAAGTTTATGCACTACGAGTGTTTGATAAAATGTCTCCATGAATAAATTATGAACAAGTGGACTTTGTTATGCTTTTTTTCAAG
ATCATGTTATGCTTTACTTTCACGCTATCGAGTCCTGGGGGTATCTAATACCAAAAAATCTAGCTGTTTACCTAGAGCTACAATAGTTATAGAATAGTCT
CAGT

chr02 21,000,028 C G C
ACAACCACTCTACCTTCCTTTCA
AAAATGGTGCGTCTGCTGTG
23
20
23
59.69
108
CATAGTTTTGCAGTTTTCAAAAATATGGGTATAAGTACTTGCTTGCTCTCACTCTCACAAAGAATTCTTAGATTACAACTGATGACCATATGCTTGCCCT
TAGTGTAATGCTCCACTAATATCAGAATACTAAGGTTAGGATCAAATAGGTCTTTTCGGGTTGTAAAGTAGGCTAAAGGGACGAGTAGGACTATTTTGGC
CAGAATTGGTGACAATGCTCCCTAAGCGCTTTAATACACTATCTTATGTCATTTACACTAACTTTTAACAACCACTCTACCTTCCTTTCATCTACCAAC[
C/G]CCCTTTCACCCATTTTGTTACTCAATCAAAAACACTATGATGGGAATATACAACTCACAGCAGACGCACCATTTTCTTTTCTTTTCTTTTCTTTTT
TATTTTTTTTTATTTTTTTCATCTCTTTTTTTTTCTTTATTTTTTTTAAACATCCCTATGATAGCCACCCTCGATCACATATTTTCATGTACCAATAACT
AAACTTTGGGGCATCACTTTCACCATTTTTCTCTTATTTTGCCACACTCTTTACTCAACTTAATTCTACAATTTAAAGCGCTTAGGAGCTTTTGGATCAA
ATTA

chr02 27,004,709 C C T
GTTAGCAAAATCAGGTAACAAGA
TGTCCATCTGGTTGTCCATTCA
23
22
23
59.63
150
ATGCAAAAATACAGACTCAGACACAGAGTTCTCCATCTCCTCAAAAAATAGATGAGAAGGGTGTGCATTTTCCACTAAATGCTCAGAAATCCATTGTACT
AGATGTTGGTACAGCTAGTCCGGTTCAAACGGTGACCAGTAAAGACAAATCAAAACCGTTAATGTCTGTCACTTTGCCAAAAAGTGAAGATGAAGGATGT
TCTTCATCAAAACATAAGTTAGCAAAATCAGGTAACAAGATTTTAAAGAAGACTTTAATATCTAAAAGGAAAAATGAAACAATAGAGACTATAATTAAA[
C/T]AGACTTTAGAAAAATTCTTTAACAACCAGACACAAGATAAACATATGAATGGACAACCAGATGGACAACACATTACCAATTCAGACAGAACTGTTC
CAGAAATAAATAATGCAGACAATAATTTTTCAAGATCAGACGAAGATGATAGTATTACAAGTCATCTTGCACATTTCCAAGATGCTCAAGATCCATATGA
AGACGATGACTCAGGAATGAGTTTCGACTCAATTACCCTGCACAACTTGGATACATAGTAAAAACAACATACAATTTGTATTATTAGATAGTGTAGTCAG
GTGG

chr02 44,502,251 G G T
TGGAGGTGGTCTTCAGTCCT
TCGACACAGCTTTGTGGACT
20
20
20
59.54
128
GATTTTTTTCTATGGTCGGGGGCATGTCAGGATCGGATGTTCTTTCATTTTAGATAGAGGCTTTGTGGGACTACTATGGGCATGCGAGGCGTCAATATTG
GTGTCAGCCTTGGTATTAGTAATGTTATTTGTTTTGGCATTGGTTGGATATTTGATTGAGGTTGTTGGATTATGGTTATAGACTTTATTTAATTTTTTTT
ATTTATTATTGTCTTATCTTGTTATATGTTCAGAATTCATTCAACTTAGGGCGTAGGGCGGTTATGGTTGGTTATTGGAGGTGGTCTTCAGTCCTGATT[
G/T]GACTTGAGGCATCCAACATGACTAGGCCTTGGTATGAGTCATGTCAGATTGGTACCAGATCCCAAGGTGTATGGTCAATTAGAAGTCCACAAAGCT
GTGTCGAGTAAAGTCTCTTTTAATGGTGTGTAGTGCGCCACACTCATAAGGGAGAGGCTATGAGGCATTTAGGAATATTTCTCTTTCTTGTGTTCTATTT
TTGAGCTGTAGAGTCTAATGTCCTGAATTCTTCTCTAATTCCTATTTGTTCATTTTTTAGATAATACCTCTACCATGATCTAAAGCTCATAAAAACTCTT
CTGT

chr02 55,000,434 G A G
TCTCGCTTTGGAGTACCACA
CCTCCACTTTCCCACTGGTT
20
20
20
59.52
148
AGGATGCTCACGATTTTGTGCTGAAATATGACCAATGCTAGAGGCAGGGGTCAATCTCTAAAAGACATGAGATTCCCTTGACTAAGATGCTTGAAGTGGA
ATTATTTGATGTCTAGGGCATTGATTTCATGGGTCCTTTTGTGAGCTCGTATGGGATGAAGTATATTTTAGTTACTGTTGACTACGTCTAAAAATGGATC
AAAGTTGTGGCCTTGTCTGATAATGAATGGAAGAGGGTTGTTGCTTTTCTCAAGAAGAACATCTTATCTCGCTTTGGAGTACCACATACTGTCATAAGC[
G/A]ATGGAGGATCTTATTTTTGCAACAAAATGTTTTGAGAAGCTTTGGAAAATTATGGGGTGAAATAGCACAGAGTGGCTACTCTATACCACCCACAAA
CCAGTGGGAAAGTGGAGGTATCAAATCATGAGATTAAAGTAATCCTAGCTAAAATGGTGAATGCTATCCAGAAAGATTGGTCTCGAAAGCTCGATGATGC
CTTATGGGCATATCGGACTGCTTTCAAGACATCCATTGGCATGTCACCATTCAGCTGGTCTGTAGAAAAGCTTGCCACCTACCAATAGAGCTGGAGCATA
AGGC

chr02 62,001,084 G C G
GGGTCTCAGAATTCTCACCACA
AGGTAGGACAAGCAAGGAGC
22
20
22
59.38
126
CTCTGTATCATCCTACTCTATTCTTCAATTCAATTTTTAACCCAAGGTTGTACTCCTTCCCCCATTAATTTTACCTTTGTCTCTAAAGTTCTCAACCTTT
TCATAACCTCAATCCACATAGCCTATGTAATTACCATATAGCCTGTTGGAACTGATTTGGTCATGGTTGGACATGGTTCTATAGTCTGTGAAGGAGAAGG
AGCACTGGATGTATCACTGTATCAGAAGGTTGGGTCTCAGAATTCTCACCACATATCGGATATCATCTACCACAGTGAATCCAGTAATAGTGGTACTTG[
G/C]GGTATCTCTGTTCCGTAGCATGTTAGCTAACATTATTGCTCCTTGCTTGTCCTACCTCATCATGGGAGTTTCTGCATTCCAAATTAACCCCAAGTC
TGTGGTTTTCTTTGATTAAATATACTGATCCATATTTGAAAGTTATGACGAGCCTGCTTCTACGCATATCTGAGTTACCAAGAATGGGAAGGCCAAAATC
ACTTTATCAGCACTCACTACTCAATCAAGTATCTCTCTAAAAATAAACTATGCACTATCAAACTCATACCCACCCTTCTATCCTATTATTAATGTTACAC
AGAC

chr02 75,004,291 C C A
GTGATCCTAGCTGAAATACGACCT
GTTAGCAGTTATTATAGCAAAGCA
24
24
24
55.6
105
TTTTGAATATGTATATGGACCTAAGGTTCTGATTACGATGTTGTGATTATTCTGAACATATGGTTGGGACAAGGGTCATGTTATGATATTGGTTGGATAT
CCGAGACGTATTTATCCTTGTAAAGGACTCGATTATTGAATATGGATGCGCATATATTTATGTTGCTTACGATTTCATTGACTGTATACTGGTGATGGCA
TGCATAGATTTAGTACATTCATTATTATTTTATTAATATTGATGTGATCCTAGCTGAAATACGACCTTATCACTATTTTTCCAAAATAAAGATTAAAAA[
C/A]CCATTTTTTATTTTAATAGTGAATTGCTTTGCTATAATAACTGCTAACTAAATGGAATATTCATATATATAAAAGAGGTTACAAATATTATTTTAA
AGATTGAGCAAGCCAGATTTTGGTCCATGATTTGACACTATTACTTACTCTGTTCATGAGACATTTTAACCCTTTCTACACTTTTACAATAATTTAGTTC
AAAAGATTATTTCGGGAAATAAAATTACAGATTTTACAGTTCTTTTAGCCACGGCTTGAGCATGTGCACCTATTATATGTCTATACATATATGTGTATTG
ATTT

chr02 82,505,226 G T G
TGGTTTGAAAAGGCTAAAGGA
AGGGGATTTTCAAGTGCCCT
21
20
21
59.21
102
ATTATTTGGGAGTTTTGATATCAAATACTTGGTTATGGTTTCCTATGAATTTAATTATGCTTTTATATGCAGTAATGGTGGCTTTATACAATTGGATTGC
ATGGTAATGGTTGAATGGTCTTTTGAATTGGTTTTGGTTATATTATTCGCCCAATGTGTTTGATAAAATGCTTATAAAGATGCGTTCATTATATTTACTT
CTTTTAATAGAACTCTTGTATGTTTTAAACTTGGTGAAGGAATTATGCATAGTTTAAATGGTTTGAAAAGGCTAAAGGATAAATGGTTATTCTTGTGGA[
G/T]AACATGGAAGTCTCCCAAGTGGTTTACTATGGTATATGGAAGGGCACTTGAAAATCCCCTTAACCTAAAAAGTTTGGCTATGGATATTATTTGCAA
GTAAGGGGTGGTATAACGATACCTCTAATATTGGGCTTAGTTAAATAAAATAGTAAATGGATTGATTGGTTATTTGGAAATAGTTTTAATTGGGTATTAA
TGGCGGGGTTTGTAGCAAAGCCATGGAATGTGGCGATCCTTGGGGGACCAAATCTGGAAACTAGTATTTGCTGATATAAGGATTGGTCTTAATGGACCAT
ATGC

chr02 88,000,230 G G C
CCACATCAACCGCCTTACCT
CTGTGGGCTGACATAATTGGA
20
21
20
58
150
TCCCGGGCCTTGTCATAATGGGCATCCTATGTCCAACTAGAACCGGGGACCACCCTCTGTTACCTAACCCAACCACCTATATTAAGCCTTAGATGGGCTG
AAATTTGAACATTGAACAAGATAGCATTGTTGTTCTCATTAAGACTCTGGGATAGGGTCGCAACCGTGACCGACCCAATCGAGTCCAACTGTACCACATC
AACCGCCTTACCTTACCATACCAAACCAAACCAAACCATTGACCATAAACCAAAGAGAATACCAAAACATAATATAAAAATCAATTCCAAAATGTAATA[
G/C]GATGGAACAACCAACAATATCATCCAATTATGTCAGCCCACAGGCTTATTCCAATGCCAAGGATAACACCAATACCGATCCCGCCCATACCAACCC
CCAAAAGTACTATAAAGCCTCTATCCAAAAGAATAAACAAATCTGGTTAGGATATGCCCCAAACTATGGCCAAAACTAATATCTAAAATAAGTGATAAGA
GTCTAAGTAAATCCATAACATGAAATGAGGCCTTTCAAAAGGATGGAAGCTCACCACTTCAGTCCAAATGTTGATACTGAATCCATGTTCTAAACAGGAG
GAGT

chr02 107,000,308 G A G
CTCACCTCAGCCCAGTCTTG
GCTATGCCCTTACCTCTCTGC
20
21
20
60.27
114
TCGATAGCTTTTCTTGGACATATTATTTCTGATAATGGCATTATAGTTGACCTTCGAAAGACCAAATCTATGAGAAACTGGCCAAGGACCATCTCTCAAT
TAGATATCAAAAGCTTCTTGGTTTTGGCTGGCTCTTACAGATGGTTTGTTAAAGGGTTTTCATCTATTGCAACACCCATTTCTCAATTGACTTAGAAGAA
AGTCAAATTCCAGTGGTCAGATTCTTGCGAGAATAGTTTTTAGGAGTTGAAGACTAGACTCACCTCAGCCCAGTCTTGACTTTGTCAGATGGTTCAGAT[
G/A]GGTTTGTTGTTCACTGTGATGCTTCTGAGTTGGTTTTGGTTGTGTATTAATGCAGAGAGGTAAGGGCATAGCCTATTTCCTTAGACATGTTAAGCC
GTATGAAAAAAATTACCTGACCCATGATCTTGAGTTGGTAGCTATTGTTTTTGCCTTGGAAATTTGGAGGCATTTTCTTTATGGATTTCATATTGATGTG
TTCACAGCTCACAAAAGTTTGCAATATGTGTTTTTGCAAAAAGATTTAAATCTTTATTAGAGAAGGTGGCTTAAGTTGTTAGAAAATAATGATATGAGTG
TGTT

chr02 120,500,036 C C A
CCCTATCTTCTCCTGCAAGTCC
TGCAGCAAGAGTTGATTTGGC
22
21
22
60
132
TCACCCTCTTGGCTAGAGCAGACTCTAAAAATAGCCACACCATTGCCAGAATTCTCCAAATATTCTCCACTCTTTCTGGACAAACCATCAATGCTCAGAA
ATCTAAGGCTATCTACTCTGCCAACTGTACTTCCCAAATGATAAGCCAATGTACTCAGATCCTTATCATCCAACCTGGCCAACAATTTGAGAAATACCTT
GGTTACCCTATCTTCTCCTGCAAGTCCAAGAATAGTGACTTCCAGTTTATCAGATGAACTCTAGGCTAGCAGTTTGGAAAACCAAACTTTTGAACATGA[
C/A]TGGTAGGTCTGTCTTAGCCAAATCAACTCTTGCTGCAATACCTACTCATCTGATGCACTACATCAGAATCCCCAACAAAATTACTGAAAGAATTAA
CAAGATCCAAAGAGACTTTGTTTAGGGGAACAACAATGACAAAAAAAAGCTTCATCTCATTAATTGGGACACCTTGACTACTGACAAGAAAATTGGGGGC
CTGGGTCCACAAGACTGAACTTAGAAATAGAGCTCTCCATGCTGGACTGGCATGAAGACTGTTTCATCAACCAACAAGCCTCTGGGGCCAAACACTCCTT
GCTA

chr02 132,005,120 G G A
TCCACTGCATGAAATTACTTGT
ACACAAACACTTGATACCACGC
22
22
22
59.71
149
CATCATATTTACCAATTGACGCATGAATGCGATCGCCCTAAATGAACAATGAAAGTTAGAATGATTGAATTCATTCGGAACATTAAAAAGGATGATTAAT
AATGAAATATAAGTGAAGGCAGTAAACTTAGAAGAAAAAGAAAACAATCAGTACCTTTGCATACTGTAATATCATATCAATTGAATACGGTATTTCAGGT
TTGAATTTATCTGGTACTTGCCAGAGTCGAACAACTAGTACTTTCAAATTCCACTGCATGAAATTACTTGTAATCTGTGAGATATTATGAAATTGGAAA[
G/A]ACATAGTTTTATGATTGTATTCAGTAGATGTCTTTTTGGAAGAAATAAACATCGACAGAAAGTAAAAAATATAAAAGCGTGGTATCAAGTGTTTGT
GTTTATGAGTGTCTGAGATTTAATTTCTAAAGATAACTGCTGTTTTTTTACATATAAATTTTTTTAGCATTTTCACAAATAATAAAAAATACTATTTAGA
CGTTTTTTGTGTGGCAGTTTTAGTCTTTTTTAAATTTGTAATTTTTAATAAAAAATATGTTTTGTTTTCTAATGAAACATGTAATTATTAAAATAATACA
AATA

chr02 135,000,227 C A C
TGCTTACACGTTTCACTAGGGA
CCCGAATGATGGGTAGGGAC
22
20
22
59.6
140
ATGATTAGTGTCTCTAAGTTTAAGTCTATTCGTTGTACCTTGTAAGGTAGAGAATGCTTCTAAGCCTATGTCCCGTGAAAACCTTATTTCATGATTAGTA
TCGATGTAAGTCAGGCCTTTTATCACCAAATTAACTATTGCATTATGTTGTGATGATTATGATTCATAGGACTCATGTGCAAGATCATCCCTATGTAAAG
ACTCATCACCTCATGCTTTGTGCTTACACGTTTCACTAGGGATTATCATAAAGCTCGTTTGATAACTTTGCATATTCTGTAGAGAAAAAATGCTCAACG[
C/A]GAGATTACATTCTTTTTCTGCATTTTTAGAACTTCAAAAAGTCCCTACCCATCATTCGGGGATGAATGATCCCAAGGGGGAAAGAATATAACACCC
TGCATTTTTTAGCTAGAAATCAGAACGTCGTTCTTACGTGTGTAAACTTTAATCCCATGACTCATATTTAAATTCATGTGTCGTGATATTATCCTACTGT
GTTAAGTGATTATGAGGTGAAAAATATTCATGGAAATCACTTAGAGCAAAGATGAACTAAAAGTCTTTCAATTGTCCAAAGTTTGGTATTCGATTCTACA
AAGG

chr02 144,502,392 G C G
GCTGGTACTCCCTTGCTAGG
AGGAGTCAATTGATTAGGCAGT
20
22
20
57.15
146
ATTTTATGGCACCGGGAGGCCGCTTTGCTGGTGCCTTATATTGCTGGAGAAAAAGCTCAAAGAAGTTATTTTTGGTCACAAGACATCATTCTTGCTAGTT
CATGGGGAATAACATATAATGGTGGCTGAAGTTTCACCATCTGGATCACATCATTTATACGAAGTTGATGAAATAATATTTTTCGACTAAGCTGGTACTC
CCTTGCTAGGGAACTGCTTTATTTTATCCATGATTTGTAATGAAAGTGTAACTGCTTTTATCAAAAAGAAAAAAAAAGAAAAAGAATCAAACTGAGGTA[
G/C]TGTACTTGTCTGTAACTGCCTAATCAATTGACTCCTATCAGACATCAGTACGGTTAACTGCTACACCAGCAACATTCGAAAACAACAACATACCCA
GTCTATTCCCACTTAGTGGGGTTTGGAGAGGGTAGAGTGTACGCAGACCATACCACTACCTCAACCTCAGGTGAAGTGGAGAGGTGGTTTCCGATGGACT
ACACAAACAAACATTATGCCACTGAAAAGTGAAACGTTAAGCTCAACATAATAGTGCTGTATTCAACTCGTGAATAAGATCTTGGTTGCTGTTCACTTCT
AATC

chr02 156,000,057 A A G
ATTTGCATCATCCCACCAGT
AGGTTCCAAAACTTGACAGGA
20
21
20
57.34
146
AAGAATACTTCTGGCACCCGCAGTATGTAGGGAGCTATCCTTGAATGATGCCCGGGCTTTCTTTCATTTTTCACTCAATAATTGATATTATGCGCTACTC
CAATGGCGAAGGTACAGTTGCCATGCGGCTTCAAGAATCCACTTAGATTTTATCAATTTCTTTCGGGCATAATCTAAGAGATCGTTAAATCTGGCTCTAC
ATCTTATTAAAAAGTTCTTCTTTATAAGAAATGTATTTGCATCATCCCACCAGTAAAATTTCTACAACAAAAATATAATATTCAATCTTTTGTTCTAAC[
A/G]AAGTGCTAATAAGTAGTCGATAAGTTAAATCCTTACCTTAAATTCTTCAAACATTCTATTCCTGTCAAGTTTTGGAACCTTTTGCCAGCTGGTTCA
GTAGCCGTTGAAATGCCGAGTAATGCATATTCACGCCTTTTGTCCAACTCCAGCATCCGTCCTAAACCTACAACACAAGATTAAATAGTAATTTCATAAA
GCATTTTCATCCCCTTCAAAGTCTCTAGACTTAACCTTTTTCAACCAACTAAGTCACCTACCAAACCACATTCAAAACGAAAAAAACCCCTTTAAAGTCC
CTAC

chr03 12,503,657 G A G
GCGAACCGAAAACTCAACGA
TGGACCACCTACCTATCCCG
20
20
20
60.11
117
CAAGTCCAAGTCAGAAGAAAATTTGAAAAATAAACCAATTGTCAAGTTCCCTTCTAACGCCAAAAGCCAATGAGGAGGAATATTTCGTGTATCAACTTCA
ACTCAGAATAATGACTATCTCACCATTTGAGAAGTCATGAAGATTCAAGTCAAAATTTTCAAAAAAGCAGCATAGATAGGATCTTTCACTTGTGTCTTTG
TTTTATTTTTTTAATTTTATTTTTGTTATTCATTTGAATGTAAAAGTAGAAGTCGCGAACCGAAAACTCAACGAAACCTGACTCAACCTCTAGCTCATT[
G/A]TCTCCCCATTTTGTCTTTTTGAACTACTCATGACCTAATTTTCTTATAACCCGGGATAGGTAGGTGGTCCAAAATCAGGACTAGGTCACATCTTTT
ATTTTATTATATTTTATTTTATCTTTACTTTTTGAATAATAGGAGGATCAAAAATCGTATCTTTGTTACTTCTTTGTATAAAAACTCTTCGAGATTTCAA
ACAAAGAGGGGCAAAATGTAGACACATGATTTTGACCCTCCCAAAGCGTAATATATATATTTTTTGATGTTAAATATTTATATTTGATCCGATATTATTT
TAAT

chr03 22,000,064 A G A
TGCATCAAATTCTTTCCACTGTGT
TCGGCAACATCAAAAGCATCC
24
21
24
59.8
148
GAGTGGTATGAGGAAAATGTAAGTTTACTTTTGCTAACCTAGCCTTCCAATCTACTCCATGAAGAAGAATCTATGTAGCAGATGTGTAATCTATTGTAAC
AGCTCAGTATTCTGTTGCAACATAATACATATCTGTTGCATAAGTTGTGTTAGCTAGGTAATCTATGAACTGATTCAGAGAACCCTCTGCATCAAATTCT
TTCCACTGTGTTTTTATTCTTTACAATTACTAACCTATTTAAAAATTGTCTTCTTATACCATAGTATGTTGATGAAGTTCTCTGCCTCATGAGGGGCAG[
A/G]CAATTAGCGTACTAGGATGCTTTTGATGTTGCCGATAGGATAATGGACCTCAACTTCTACAATAATTTCAGAGATAGGTACAATGATCTCCGTAAT
CTATCTAATTTTGGTGGCTTGGGATTTGATAAGTTACTTTCTACGTTCCAATGGGATGAAGAAGCAATTAAATATGTTAGAGAGAAGAGGTCATATCCAC
ACGGTAAGAGCTGGATCAAGGTAAAGAAAATCCTTGAAGTTATGAACATGAAAGTCAAATATTTTCTCATTGTTGAGATACTACTCTATGAGGGAAATAT
TAAG

chr03 41,505,774 G G C
AGGCTTCTTCTACAACAAATGT
TTGGGAGGTGGAGTTCGACT
22
20
22
60.47
115
TTTAACTATAATTAGTCGTCAATTAATAACTCAATTCGATTATTAATGAATTAGATAGTAAATACATTATCAACTAAGTGTATAACCTATCGAAGCATAT
CATAACCTGCTACAATAGATGTAAATATCTTTTTGATTATTTCAAACAGATTATACATCTGCTTTAACAAATTACTTATTTGTTGCAACATATATAATTT
TTTTTGGAAATAATCAAACATATTAGGCTTCTTCTACAACAAATGTATATATTTGTTTGATTAGTTCCAACATATTAAACATTTTTTACAACATATTTA[
G/C]AGTGTGTTAGAAATATAAGAGTCGAACTCCACCTCCCAATAATCCTTTCTTTGTACAAAGGGGTGGATCCTCATCACATCCTTTAAGCATAAGGTT
AAAAAATAGTTTGAACGAGGTGCAACACCTAATTTTGGGTTAGCCTCCTCCGAATCATTTTCACCCCGAAATGAACTAGAGTCATTATAAGAGATTTGCT
TTGATTCTTCTCTTGACTCTTGCATCATTTCTTTTATTTTGGATTATTCTTCCTCATATGAGTTGGGTGATTGGGAAGTCACCTAGGAGTCTTCTCTACT
AAGC

chr03 55,502,194 C C T
CGATGAGGGCTCTGGAATGG
CCACATTGCGCCCTCTAGTG
20
20
20
61.09
143
TACCCCACTAGATAATTTCGTGAAGATTCTTGGGAATTTCTTGAGGTTTGAAGTTCGAATTCATTGATTTCTTGAGTAAGGGTTCGTTTGTTCTTGAGGT
GGAAGATGGTTTTCTTGAGAGATTTTATGAATAAAGGGGCAAATAATGCTCCTTGAGGACCTAAATTTCATGTTATGGATGAGTTTGGGTGAGGGAATTG
ACCCAAATAACCTTAATTAACAAAGAACAAAAGCTAGATGGATAAAGAAGAGTGCGATGAGGGCTCTGGAATGGCGCACTGGAGGGCGCAGTGTGGGCT[
C/T]TGAAGCGGCGCACTGAAGGGCGCGGTACGAGCTCTAGGCTGGCGCACTGAGGGCCGTGGCATGGGTCTGGTGCGGCGCACTAGAGGGCGCAATGTG
GGCTCTGTAGTGGTGCACTGAGGGCGCAGCGTGGGGTTATCCCCATGCTGCTACTATTTTGGATTCCCAAACACACCACTATGCTCGTCTGAAAATTCTG
AAACTCACTTGAGATGTATTTTTAACTACCTCGATCATGAATCAACTGAAAAATCGATGTTCTTAGTTCGGGAAGGTAAAAAATAGGATCATCGAAGTTT
AGGG

chr03 92,007,091 C C A
TGGAATCAACAAAACTTCCATCA
TCTTGGTTCAGGTCCCAACG
23
20
23
59.89
129
TATCCCAAATATGCATTGCGGGTCTATATATAGCCCTTAAAGGTAAAGATATATCGTTATCACAATCCTATGGGCCACGATTGTAGTAGCATAATTGGCA
TACAATTTGTCGCGAACGCGATTGCTTTCTTGGGTCCCAGGTGACAACAAAATCAAAATCATTATATTTACCATAGAAACTCATTTGGAACACAAGATAC
ATGATCCAATAGTGTAATTTAAGTAAAACCACATTTATAATTCATTGGAATCAACAAAACTTCCATCAAAGATTAATTCAGTTAAAAGTGAGGCCCACA[
C/A]ATATAGGTCCATTTTTTATAAAATCTTTTCATTAGCTCAAAATAAGTTTAGAAGCGTTGGGACCTGAACCAAGAATCACCCTAGACTATAATATAC
TATCTAGATGCAATGACTATGTTGGATTATCCATCCGAGGTTGTTTCAACAAAATATGGGTCCCACACACATATACTTTCTAGGGTGCATTGTAACCTAA
ACCAAAGTTATACCAAACCTAAAATTGATATATTATATCTACTAGTGCTGTCGACATTTGCATCAGAGATAGTTTCATTAAAGCTTTCACCCAGTGGTCA
TTTG

chr03 95,502,670 C G C
ACCACGAGGAAAGAATGAAAAGA
GGAAGTTCCTTAATACCCAAAGGG
23
24
23
59.05
140
CCAAAGAGAACCATCCTTATTATATATGAAAAGCATAGGAGAACCCCACGGAGAAACACTGGGATGAATAATCCTTTTATTAAGAAAATTTTTTAACTAC
TCCTTTAGCTCCTTTAATTCACCTGGACCCATTTTATAAGGAGGAATGGAAATAGTATTAGTATCCGGTAGATGATCAATCCCAAAATATAATTCTCTAT
TAGGAGAAATTTCAGGAAGATCATCAAGAAACACTTTAGAAAATTCATTAACCACGAGGAAAGAATGAAAAGAAGGTCTTTCAAAGTCAGAATCCTTAA[
C/G]CCAAGCTAGATCATATAAATACCCTTTTGAAATCAATTTATGAGCTCTAAGATAGGAAATAAACCTCCCTTTGGGTATTAAGGAACTTCCTCCAAT
TCTAATACCATCTCATTAGAAAAGTGCAAACTAACCTTTTGGGTCCTACAATTAGAGAAGCATAGCACAAATGAAGCCAACCCACCCTTAAGATAAATTC
AAAATACACCACATCCAACTTCATCAAATCCAAAAATGTCTCCCATTGGAAGATAGACACCATACAACCCCTATAGATTTTCTAGCCATAATAGAATCAT
CCCC

chr03 110,009,569 T C T
TCCTCTTTAAAGTCCCTACACT
GGGTATTATGTGTTTTGAATCTGG
22
24
22
56.06
118
CATTCAAAAAACAAAATTCCCTTTCAAGTCCCTACATCCCTACAGTTAACCATTTCCAAGTAACTAAGTCACTAACCAAAACCACATTCAAAATAAAAAA
TCCTCTTTAAAGTCCCTACACTTAACCATTTTCAAGTGACTAAGTCTCCAACCAAACCCCATTCAAAACAAAAATCCCGTTTAAAGTCCCTACACTTAAC
CATTTTGAAGTGACTAAGTATCAAAACAAATCCACATTCAAAACACAAAATCCTCTTTAAAGTCCCTACACTTAACCATATTCAAGTAACTAAGTCACC[
T/C]ACAAAATGACATTCAAAACAAAAAAAACTCCTTTAAGTAACTAACCAGATTCAAAACACATAATACCCTCTAAAATTCCTATACATAACCATTTTC
AAGTAACTTACTCACCAACCAAACCAAATTCAAAACAAAAAATACCCATTAAAGTCCCTATACTTAACCATTTTCGAGAGACAAAATATCAAAACAAACC
CACTTTCAAAACACGAAATCCTCTTTAAAGTCCCTACACTTAACCATTTTCAAGTGACTAACTATAAAAACAAAACCAAATTGAAAAAAAAAAAATCCCC
TTTA

chr03 111,002,506 C C T
GCCTAGTCCAGGGTGTCATT
ACTACCATGAACCTTGGCCT
20
20
20
58.63
89
TTCCTCGATTGTATATTAAGTTATTTTATAAAATGTTTATTATATTGTGTTAGATTTGGGATATTTTTTAGGTTTTGTTGATTAAACTAGAAATTCTTGG
GTTAGATGGAACGTTTAAGCTATTCAAAAATTGAAATTTAGTCACAATTGACTTAGTCGCTCATGTTTTAGGTAAAACTTCTACCTCAAAGAGGATTTGG
GCTTATTTGACATCTAAAAGTGGATTTATACACCTTAGCCTAGTCCAGGGTGTCATTTGTTTTGAAATTTACTTTGAGGATTAGAAGTCTACCTTTGAT[
C/T]CACTTTAGGCCAAGGTTCATGGTAGTTATATTAGACTATTCTACGCATATTATATGCCTTGAAAATGCTTATTGAGGAAATAGTGAGCAACTTTGG
CATTTGATGGTTATGATTGGTTGGTACTAAGAATTTTTGCTTATTGATTATTCTAGTTAGTAGTGATTATAGCATTGATTATGCTAGTGGTTATGTTATT
AATTATGATAGCAATTTTGCTATTAATTATGCTAGCAATTTTACTAGTTATTATGCAAGCGATTATCCTATGATATTGATATATAATTATTGGTTCTGAT
AGTG

chr03 118,002,621 A A G
GTTGGGCCTGAGGTTGAGTT
AGAAAGAGACCCCACGTTGG
20
20
20
59.6
131
AATATATTGACCTAAGGGACCTTGAGCTTTGAAATCCACTTCACTATATGAGAATATCGATTTGATTAGTGGGTTTGTGGTAAACCATGAGATTATTCTA
AAAGTGGATTTTTATGATATGAGCACAGATAATCTAAATGGAGTAGTATTTAGCACCGAGCGGGTAAGCTACTATAGTTTCTTACCCTAAAACTATGTGC
CACCGTAGGTTGGGCCTGAGGTTGAGTTTATGATGATTATGATTGAGCCCGAGGCCGAGTTTCATTTAGTGATCACTAGACTTAGGTTATATTTCCTGG[
A/G]AAGAGTATGATGCTCCTCCCCAACGTGGGGTCTCTTTCTTAGGAGGACAAAACGTTGGAATCCATGTAGCTCGCATGGTTTATGCCAATTACAAGA
ACCTCCCTTGCACTTTTAAACTTGAAATCAGCTACTCCTTTGCAAATGAAGGTATTTTTTCCCTCCTATGAATCCTTTTCACTAAACTAGAGCATTTTGC
CTTCAGATAGATGATTTTTCCTAAAGTTTAAAATGAGATATTTTCCTAACTTGCATGATATGCCTCTATGTATTTCTGAAGTATCATGAGGTCGTATTTC
TAGT

chr03 184,500,064 T T C
ACGCCTGCACCCATTATTCA
CTCCTTGACCGGAGCATCTC
20
20
20
59.9
133
CAAATCCATGCTTCGAACTGAACTTATTCAAGGTAATCCCTATTTTTGTAGCGGCCCATGGGGCTTCTCTTGCCGGGCATAGCTGCGAGGCTAACCAACT
CTCTGGGGCATAGTATTTTGCCTCAAACTCCTTCGGTCCGGCATTCATCAAACTATATAGCTCATTGATAACATTGGAGCCAAAGTTGATAACCTTTCCC
CAAATCCTTATCACTAGGTTGGATAGGCTTACGGCTTTAAAGTTTGCGTAAAACGCCTGCACCCATTATTCATTGACTTTGCATAGCTCCAGGTCAAAA[
T/C]ATCTCCAGCCCATAGCCTGTAATCTCTGATAGAAGGCCAAATATTTCTTAGGCACTTGTTCCAATGAGATGCTCCGGTCAAGGAGTAGTTTTTTTT
TGGCCAGATCCTCATAGTATATGATCAGACAGTCGACTACGAGAAAGCGGGTTTGGTTGAATTCTGCCATGCTTAGCTTTTTTAGAAACCTGAAAACAAC
ACACAAGAATTAACCATCAAGATCATCATGTGAAAACAATGCTATGTTATTGAATGAAGCTAAAGAAATGACTTAAGGATCATATTAGGGCTTAAAAATA
GATG

chr03 188,001,369 C C T
TGCTTGGTTATGCATTCTCA
TGCTAAATGGGGTTAAGCTGA
20
21
20
57.27
129
AATAGTTCAGTGGACCCACATAGCCATTGTTAGTACCCGTGGTATGGTACCAATATCCTTCCAGCTGGGGTTACCGGTTGAACCCCTTTTAACTTATTTT
GTGGTACGTCAGTTAGATGATAGCTCCTATAGTTTTAGTCCACTGATCAGTCCAGTACTTAATTTCAAGTTTGCTTGACCATGGCATATAATCACTAGTT
GTGCAGTATCAGTATTTCAGTATGTCAGTTTACAGACTATCCCAGTTTCATGTTATATGCTTGGTTATGCATTCTCAAATTTTATAGCTTTCATACATG[
C/T]TATGCATCAATTATCTTATTCCATACTTACAGTTAGTTTTTATTCATGCACATGAACTATGTATATCAGCTTAACCCCATTTAGCATACCAGTATA
TTCAAAGTACTGACCGCATTCTCGTTTCTTGTGCTATGATATCTCATATCATAGGTTTGGACGCTCATGTTCTTGACCGTAACTAGGCACTCCAGTGCAT
CTGAAGTAGTAGAAGTGGTGAGTCCTCATGTTCTGAGGACTATTTATGTCTATTTTAGTTCAAGTCAATAGTCAGTCGGAGTTAGTTGGGGACCTGCCCC
ATCA

chr03 189,500,013 A A G
GTGCAAAAAGGACTCAGCTT
CCCTAGCTGAAAAAGAATAACAGA
20
24
20
56.69
146
GCATGTGGGGGTGAATGCATGAGTAAAACAATAATGTACTATTCATACAAACTGTCAAATACTGCATGCTAAGTTTAAGTGACTCACCTTGGCTTGAGTA
ATCAAAACTGTAAAATCATAAATCATGAGAAGAAAAGCGCAAAGGTAATTCTATGAGCCATCACACTTAGTTCTAAAAAGTTGTAGTCTTATTCTACTTT
CAAATCATGTTAGCTAAGTGCAAAAAGGACTCAGCTTTATAATATGATAACTAAAAGCTAAAATTTGATAACTAAAGTCTTATGTAAGACAATATCTGA[
A/G]TAAATTTGTAAGCCTTTACACTTAGTTTCTAAAAACTATTCTGTTATTCTTTTTCAGCTAGGGAATTCTTTTAAGAACGTTTCTATCATTCTTTAT
TAGTAGAGAGGTTCTTCTAACCGACATAAAACATTATGAGCCATCATGGAGTCCAACGTATTATTCCTCTAAGAGGAAAACCTCACATTGGGGAGAGGTG
TCATACTCTTGCCAAGGAGTATAACCTAAGCTATGTGATCACAATCTGCATCTGCCTCCCTATAAATAGGAATAATCTGATTTGTACCTATGTTGGCTCG
TAGT

chr03 218,500,306 G A G
TGGCCATTTGGGAGGACAAA
TGGCATGCCCCGATAAGTTT
20
20
20
60.03
133
TCCCAGTATGGTCCGTATAATTTTTTGTGGCCATTTGGATGGACAAACGGGCAAAACGATATGAATGGGGCATTTTTGGCCTAAATTGCTGTGCTATAGC
TCACGGTTTCAGGGGTGGGCCCAGGTTATGGATGTACTGTGTGCTAAAAATCTACCGAGGCATACCAGGGTTATTGGCGATCATCCCAGTACGGTCCATT
TAAATTTTTGTGGCCATTTGGGAGGACAAACAGGCAAAACAGCGTGGACGAGGCTTTTTCAGGCAAAATTGGTGTGCTATAGCCCACAATTTTGTGGGT[
G/A]GGATCGGGTGTGTTGTGGGTCAAAAACTTATCGGGGCATGCCAGGGGTGTTGGGGATCGTCCCAGTATGTTCCGTTTAATTTTTCGTGGCCATTTG
GGTGGACAAACATCAGAAATAGCACGAATAGCGCATTTTTAGGCCAAATCAGTGCCCATGGTTTCGGGAGTGGGCCCTGTGTTCGTGTGTGTTGTGGGAC
GAATATCAACCAGGGAGTGCAAAGGAGGTTGGGGATCATCCCAGTGTAGTCCATTTAATTTTTCATGGCCATTTAGGTGGACAAACGAGTGATACAGCGT
GAAC

chr03 221,549,314 C T C
ACATGACACCCGAAGCTTTC
AGCAATAGCATAGCAGAGGCA
20
21
20
59.58
128
GATGAAACTCTGTATATTTATGTGTATATGTATCAGTTAATGTATAAATATTATGCTTGGCACCTACAATATCAAAGGGACTAGTGGCGTAAGTGGTTGA
AATTGTTTGGCTATGAAGAAGAATAGAACCCAGACCTCTTCTTACGAACTAGGCAAGCCTTCATGTAATACTAACACTTGTTAGAGATATATAATTATAG
TTTACTTTTTGAATATTGATTTCACTATCCTAAAATATCATACAAAGTATACGTTATTATTCAAAATAACATGACACCCGAAGCTTTCGAATTTTGGAT[
C/T]CGCCTCTTTCTCCAAACCTCCTATGTCTCCAAACCTCCTAGTAATAGTATAGTTATTACTACTACTTCCAATTTATGCCTCTGCTATGCTATTGCT
TCTTATTTAATTACTTCCATTCAGTTAGCGCCCCCACCCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNN

chr03 222,004,054 T G T
GGAGGGTCCTGAACAGAAAGT
GGACCCTCCTGATAAATGGG
21
20
21
57.04
84
AGTAAAATCCCATTTTTCAGGAGGGTCCTGAACAGAAGGTAAAATCCCATTTTTAAGGAGGGTCCTGAACAAAGTATAAAATCCCATTTTTAAGGAGGGT
CCTGAATAGTTAGTAAAATCCCATTTTTCAAGAGCATCCTGAACATGTGGTAAATTCCTATTTTTCAAGATGGTGATGAATCGCAAGTAAAGTCCCATTT
TTAAGGGGGGTCCTGATCATAAATTGAAATCCCATTTTTCAGGAGGGTCCTGAACAGAAAGTAAAAATCTCATTTTTAAGGAGGGTCCTGAAAAGAAAA[
T/G]AAAATCCCATTTATCAGGAGGGTCCTGAAAAGAAAGTAAAATCCTATTTATCAGGAGGGTCCTAAACAGAAAGTGAAATCCCATTTTACAGGAGTG
TCCTGAACAGTAAGTAAAATCCCATTTTACACGAGTGTCCTGAACAGTAAGTAAAATCTCATTTTTAAGGAGGGTCCTGATCATAAATTGAAATCCCATT
TTTCAGGAGGGGCCTGAACAGAAAGTAAAAATCTCATTTTGAAGGAGGTCCTGAAAAGAAAGTAAAATCTCATTTATCAGGAGGGTCCTGAAAAGAAAAT
AAAA

chr04 19,000,067 G A G
TGGCTGATTTATACCCACCA
GCCTAACGAATCGCCTATGC
20
20
20
59.21
137
TACCACTGTAATACCCCACATGTTTCTAAGCTAGGAAGTGAATAAGTATTCCTACGTATGAAATCTCCTATCCTGTGATTAATACTTGAGTACATGACTT
ACAATAAATATCCTAGTGATAGGATAGCTTATGATGCATTAAGCATGTTCATATGACTCACTTAAGCTAATACAAGCTAAGAGTTTTTAAATCCATCAAG
TTTTAGTGTTTGATTTTGTAAGGGTCATCTTTGAATAAGTATAACTCAATGTTAATGTGGTATTTTGGCTGATTTATACCCACCAAATTGTGGAGAATC[
G/A]AATTAGCTTTCCAACGATACCAATTTTCCCTTAATCCAATAGCCGAGCAAAAAGTTATGCCCATTTTCGTGAGAGACAATAAGCATAGGCGATTCG
TTAGGCGCCGCTCAACCCAAGCATAGGCGATTGGTTAGGCTCCGCCTAACCTAGCTTAGGCAATCATTTGGACGCCGCCTAAGTCAATTCCAGGTGCCAA
AAACACTTCATTTTAAGTTATTTTAAGGGTAATTAAGTCTTTTAACACTCCTTACACATCCCTAAACTTAGCCCTATGAAATATATAGCTTCTAAACATA
TTAC

chr04 29,503,334 A G A
ACCTAGAGATAAAATACCCGCCG
TGCTGCGAATTTTGTTGGGG
23
20
23
59.97
104
ATAAAATACCTGCCGATATATTTTTTCAGCTAATGTTGCAAGTAATAATTTCGCAGGTAAGTCCCCAAGAATAAATCCCCAGCAAAATTCGCAGCACAAA
ATCCCCAAACAATTTTCTAGGTAATAAAATCCATTACATAAATTTTCACCAAAATATCTCTAAGTAAATCCGTAGGATAAATTACCTTGGAATTTTTCTA
TGGATTTAAAAAATATATATATTTGTTAATATACCTGCGAATTTACCTAGAGATAAAATACCCGCCGATATATTTTTTCAGGTAATGTCCCAAGTAATA[
A/G]TTTCGCAGGTAAATCTCCAAGAATAAATCCCCAACAAAATTCGCAGCACAAAATCCCCAAATAATTTCGTAGGTAATAAAATTCATTACTTAAAAA
ATATATATATCTCCATATACCTGTGGATTTACCTAGAGATAAAATATCCACCGATATATTTCCCCAGGTAATATCGGAAGTAAGAAATTTGTGCAATATG
GCACCAAATTTACCTGCGGAATTTGTTGCAAATATATGGTTCGCAGGTAATATATTTTAATATTGAGGAATTTAATATTTTCGTAGGTAAACCTGCATGT
ATTT

chr04 31,501,078 G T G
GCAAGCCTCTGATCTTCTCCA
AAGTCCACTGCTGTTGACCT
21
20
21
59.16
149
ACATGTTGAGTGTGCATCAACACATTTTGACCTAAAACAAACACAGCAACCCTTCATGTATCCTTTAAGGCTTCTAAAGAAAGTTTTTTGAAGGCCTTCT
TCAGTGCCACAACTTTGAAGGTAGTGTTCCTGATCGAGCTCACAAGAGACCAGGAACTCTATACCAAATTCAAAGACGACAAGGAAAAAATTAAAGACTG
AATCGGCAAGCTAGAGAGAAGCTTGAAAATTATCGGGATTCACATACTACAGCAAGCCTCTGATCTTCTCCAAGGAATGTTGAAAGCATGCTAAGGCAA[
G/T]AAAACACAATCAATTAATCCATATTGCTAAGGAAGTAATGATACTCAATTTGCCTTTCAATCTCGTTTGTGGTTCCGATTAGGTCAACAGCAGTGG
ACTTAATCGGAACCACAAACAAGAAGGCATGGTAAGCAATTTAAAATTCAGAAATTTTTGCCTTCACTTAGATTATTTACTTTAACTGCAGTTGCTATTA
GCGGAAGTTTTCTAGACTTACTGTACATCATTTCAACCTTCGATGCCCGTAAGGCTGCTTTCTTGGTCTTCTGTTATTTTTTATCTATGTGATAATCCTG
ACCA

chr04 50,002,105 C C T
TAGAGGTCGTGGATAGCCCA
ATAAACCCTGGTAGAGCCTG
20
20
20
56.3
150
AAGAGACATTCTTAGGATTTTTTTACTTCTTTCACTCATATCTTACTAAGAGTCTGAGTTATTTTAAAGAACATTCCTTTTATTTCACTCTTACGTAGAT
GACAAGGAGTGTGATACCACTATACCAGATAGGGGTCCCAAGACCGAACCTAGGGATCCAACTTCTATTCGTGGACAACCTAGAGGTCGTGGATAGCCCA
AAGATATATCCCTACAGAGGGTTAAGGATAGGGGACCTTCTCTAGACCCTATTCTGGCTCCTGAGCCAGTGATTCTTCTACCTCAGCTAGTAGTGGACC[
C/T]GGGACCAGCCCAGGCTCTACCAGGGTTTATTTCTTCTTCAGTTCTTAGAGATGCATTGGTTTAACTTTTAGGTTAGCTTATGGTTCATCATCTGAT
GGTGCACAGTTTATAGATAAAAGCGATATTGAGGTGGTGGCGCAGCCTATAGTTGCGACTCCTACAGTTAAGGTTCCTTCTGCACCAGTAGTTGATCAGC
AAGTAGTTGCTCAACTAGTGGTTGTTCAGCCTGCTATATCTTCTGAGGAGCAAAAGATGTTGGGTAGATTCTTGAGATTGGATTTGCCTAGGTTATTTGG
TGCT

chr04 52,508,655 G T G
ACAGAAGTGAGGAGTTGCACT
GCTACAAACTAGCCACCATGT
21
21
21
58.29
124
TTACTTGACTAGAAAGTGCATCTTATAGGAGTAAAGGTTCAAGATAGGAAGTGTGTCTCCTAATAAACAAAACATAAATTACCCAGACAAGGAAGTGTGT
CACCTGATGAATAAAAATTGAATCACACAGATTAGGAAGTTTGTCTCCTAGGGATATAGGATGATGCATTTTTACCCTGATTGTGATTTGATTTTCAAAC
CAATGCAGCAATACTGTATCTTACATTTACAGAAGTGAGGAGTTGCACTTCTCATATTTAGGCATTGAATCCTTTGATTTGAAGGTAAACTTTGTTCCT[
G/T]TCTCATACAAACAAAATTTGTGAGTATAAAAACATGGTGGCTAGTTTGTAGCTTCAGCTTCCAAGGAAATCACTCTTTCACTTCACATTTTACTTG
CTTCAAACTATTGTTATGTGTCAGTGACTTGTTACACCATTGATCCAAACTCCAACTACTAAAAGTGACTCTGAAACAAATACAGTATCTCTATTTTGCT
ATGTCTCTGAGATAAACCCTTTAATCCTTGGTGTTTCCATGAATTCCTAAACTTTTCTTTTGACAAAACTTTCTTCGTGATTTGTTTTGACTTACAATTA
TGGT

chr04 64,508,596 A G A
AACAACAAGTTATGCCCCGT
ACTCTTGCCAATACTGAGTAACT
20
23
20
57.25
144
ACCACATTGTGTCTTGATTAATGAGATGTTCTATAACTCTTGCCTTAGAGGCAAGACTTAGCCCAGGGACTTTGAGACAATAAGCTATTCCCCATGTGAA
AAATTTGACATCATCACATTGTGTCATGATTTATGAGATGTTTTATACTTCTAGTCTTAGAGGCAAGACTTAGCTCAAGAACTTCCAAACAACAAGTTAT
GCCCCGTAGGCAAGAATTGACACTACGACATTGTGTCTTGATTTATGAAATGTTCTATTAGATTTTTATCTAAGACAAGACTTAGCCCAAGAACCTCTC[
A/G]AAAATATAAGTTACTCAGTATTGGCAAGAGTTAACACTATTTCATTATATCTTAATTTATGAGATACTTTATAACTCTTGCCTTAGAGGTAAGACT
TAGTTTAAGAATTTTCAAACAATAAGTTAAGTCCCACAGGCAATAATTGACACTAACACATTATGTCTTGATTTATGAGATATTCTATAACTCTTGTCTT
AGAGATAAGACTTATCTCCAAGGACTTCAAAACAACAAGTCATGCCCTTAAATTTACTTCGACATTAGAGAAAACAATTCTTCTTGGCAGATTATCATAT
ACTT

chr04 97,500,152 T T A
GCACCAAGAGTAGTGAGCGT
ACCATGAACATCAAGGACTGGT
20
22
20
59.62
113
CTAAGTCCAGAAATAACTATCATGATGGAGCGCTAGGCTCTGAGGCCCAGGGTAGTAAGAATAGAAGTCTTACTTATCCACTTTTCAAAAAGTATGGTAA
GAATCACCTAGGTGCATGTAGGGCAGGTAGTGATGTATATTTTGGGTGTGTAAAACCATACCTCAGGATGCGAGAGTATAGTGTTCTAGAAAAGAGGGGC
AAAAATTTGCCTTAGTAAGGCACCAAGAGTAGTGAGCGTCAGAATAGACTTTATGCACTCCAGACCCGTCATGATCATAAAAGTTTCCCTAACCTAGAT[
T/A]CAAGTACGTTACCAGTCCTTGATGTTCATGGTATGCATTGTTAGATCTCTTTCTATGATTTGTACATATGTTTTAGCATGATTTAGTTAGTAAAAC
CAGCAAGTCTATTTAGCAATCGAGCAGTCAGATTTGTATAGTTTGTTTCCTCATCCTTGCATCTATTCATGCTATCCAAGATCTCAGGGAATGTATCAAT
TCCAAGTATAACCTCCTAGTATTTGAAAGTTCAATTCAATTCATGCATCATGCATTAGTCTCAGACTCCCGAGGTTTAGTTATAATCTTGTTCGTAGATG
CCTT

chr04 99,513,751 G G A
AGGGTACTTTAGGTCATGGGT
AATGTGTCCTCACGAGTCGT
21
20
21
59.04
123
ACTCAACCATTAACGTAAAAAATTCCTCAACCTAAATTCATAGCCAATAATCAACCACATGGATAACAAGTTTAAGAAGATACTTTTAGCAAAACAAGTT
TTAGGTAAGAGACACATACCTGAGATACTAAGAAATTTTGAGAAAAAATCACCATTTGAGCCCTAGATGACCAAGCCTTAGAAAACCCTAGTTGTTATTG
CTTAAGGATCTGAGAGAGTAAAGAGTGGTTTATGATCAAGTAATGAAGTGTTATAAGTCCCCTTAGGGTACTTTAGGTCATGGGTTTTAATTGGAGAAT[
G/A]AAGGAAATAACCAATGTACCCTTAAATAAAATGTAAAAAACTGCTGCCAGTTACTACGAGTAACCTTACGACTCGTGAGGACACATTATGAGTTAT
CACCATAACTCGTGGTCTGGACAGTAACTTAGAGCACCTTTATTGGTTTGGTCATGAGTCATACCCTACGACTCGTGACCAGACCTTACTACTTGTGGAG
TCTTAGTCATTTCCAAGATAACAACATTGGTCTATCTGACTAGTTTGGTCACGAGTCCCACCCCACGACTCGTGACCTTACCTTACGATTTGGTAGGTAC
CAAT

chr04 111,500,965 G G A
TGGTTACGCATCAGTTGACAC
ACCTAAAAACATGATGGCATAACT
21
24
21
56.9
142
TTTATGAGGTAATTCATTCAAGACCATGCAAGTCATAAATTCAGTTCAGTTCATGCATCATGCATCAGTTTCAGATCCCAGATATTTAGTCATATTTCAG
TCTGTAAGTTTCCTGTGCATCATCTCAGTCTTTCTTTAGTATTACAGCCAAGTTAGTATCATTCGGTAGACGAAGTATCCCAAGGGGAGATGTAATACCC
CGAGTATTCATGTCTTGAATCTTTTATCTCTTCCTCAAGAAACAAGATCCATCTTGAAGTAATGGTTACGCATCAGTTGACACTCTTATTTCTATCTCA[
G/A]CCTTATAATCATTCTCATGTCAGTATTTACGAAATTAGTTCAGTTCATGATATTTATGTCATATATCATGTTTCAGAATTAGTTATGCCATCATGT
TTTTAGGTATATATTTTCATAATATGATTTCAGTACCTTCGTACAGTACTCTAAGTCTAACCAGTCTCATTCGAGGATGAATGTTCCCAAGGGGGAGATT
ATGTAATACCCCATATTTTTGAGCTAGTGTATGAACCGTCGATCTTACTTGTATAAGCTATAATCCAAGTGATTCTCATGTGAATATAAGTTCATGATCT
TTAT

chr04 144,501,385 A C A
TGCAAGGCCTTGTTGAATGG
ACACCCAGGACTCGATAACA
20
20
20
58.07
142
TATTTAAGCCCATGCATACCAAGTGTTTGTTGAAAAGCCTTATTGAATAAATTATGGCATGATAGCATGAAATTCCCCAATTATGTTCTCTTTGATACAT
GCTAAGACTTTAATACATGCTACGTGTTTGATGAATGAATTGTAACATGACAGTATAAAGTTCCCTAATTATGTGTTCTCCGGTACTTGCCAAGACTTAA
ATAAGTGCAAAGTTCTTGATGCAAGGCCTTGTTGAATGGAGTATGATCCAATAGCATGTCCCCCTATGTTATTACATGTTTAGGATTCCTAAATGCTTG[
A/C]AGTGATTCCTTAGTGATTGTGATGGTTATGTTTTATTTTTATGTTATCGAGTCCTGGGTGTATTTATACCTGATAATTTAGCTGTTGTCTAGAGCC
CGTGTTCGTTTTCACAATAATTCCAGTCGAGCCATGATTCTTAAAACTCAGTGAGTTATAGAACTCTATATTCTTAGATAGATACAGAACTTAAGAAATC
TTTGTAAGATCTGTAATCATTATAATCTCAGTATCGTTAGTAATCTAGCCTCAGTTTTGTGCCCAACTCAGATCTAGTAGTATTCAAGTGCTTAGTTATG
ACCT

chr04 157,003,105 G G T
TGCATGAGATCGTACTATCTTGAC
GGCCTAAAACCCATGCTTTA
24
20
24
55.97
111
AAAAGCCTTCAAGAGCATCCTTAAGAGTTCAAAGTCAAGTTTCTTCATCAGATTAAGCCTAATAAGGTATGTGGGATTATGAACAAGGGATTTCTTTTAC
CCTTGTGCCCAAATTTCATGATTTTAAGATTTTATTTCCTTATTTTGAAGTAGGTTTTATACCCAATTTTACATATTCTTAAAGCATGTGATTATTATGA
GATTTAAAACTTTAAGTTAATCATGAATTGTTTATGATTATATTTTTATATTATGAGATTTCTATCATGCATGAGATCGTACTATCTTGACTTTATTTT[
G/T]TTGAAGTATTTTAAATATTGCTATTGATCATGAAGTTTTGTTATGTATTGACTAAGATTAAAGCATGGGTTTTAGGCCCTAAGTTTAAGTATCGAG
ATTTCAAGAAGATTATGCTCTTAAGAATTATTTGACAAATTCATACCAAGAAAGAGTTTGATTTTTTAATAAGACTATGGTCTTAAGTTTCTTTGATGGT
TTTATACCACGATTTAAAGAAAGATAGATCGTATGATCCCAAGCTAAAACATGGAATCCACATTTATTCAGTTTGATTACAGTTTAAAGTAAAGAGAAGC
ATAA

chr04 159,502,325 C C A
TGGTAGCCAACTTGCAAGGA
TCTACTAACAAGTGATGGGCCT
20
22
20
58.55
140
GGGTGGAAGAAGGATACACAAGTACATTACTGAAACCATCTAATACTACATGAAAGATGATGCCAAATGGCTTATGGAAGAAGTTACCGTTTATTAAAAG
CTTCATGGAATTACCTAATATAGTTTACTTTGAAACCCTTACAATTGGGTTACCCTCTCATATGGGTTTTCCTACAAGCTGCTTATCTAGCTACTTGGTA
GCCAACTTGCAAGGAGTTTAGAAGTTGTTGATCCACCTACTTGACAAGCAACTCAGTCACCTTCTTGGATATGTTGTCACATGACATCAACATACATGT[
C/A]TTTTGTTTTTATTAGGCCCATCACTTGTTAGTAGATCCCGACTTAAATAAAATAGGTTGTAAATATCTGATAGAAGTGTTTTCCCAAAATAAGGAT
TAACTAGTTGGAGTAGATAGATAGGATAAGGTTTATCTCTATAAGAAGATAAGACTTATCTCTTAGGATTTTTTTTGTTTCGAGTTTATTTCTACTCCAA
GCATATCTAGAGGTTCCTTCTCCTATAAAAGGCAGCATAGGCCATTAGTTGGCGATCATTAGACACTTTATCTAAGAACTTTTCTTAGAAAGTTTCTCTT
TCAA

chr04 166,500,017 C T C
AATGATGTTGGGACCCTTCC
GCCTCCTATGCACAACTTGG
20
20
20
58.9
87
TGATAATGAGTATATACACAAGAACACCTTAGTTGAAGTTAACTTGTGTGATACCTTTCTCTGCCCTCTCTTCGCTTATAAAATTGCCAATGGTAATATA
AGGAGTAAACAAAATAGTGAAAATGGTACATTTAGGGAAAGTGAGTATTGCCATGACCCATGTTCTTGGCTAATTCTTCCATTTGACCCCGGTGACCTTA
TGGGATATGGTGATTTTCATACACCTAACTTGATGCTTGGTCTAGATGACAAACAAAGTTTGAATAATGATGTTGGGACCCTTCCCTATGATAGAATGT[
C/T]TTTCTTAAGGATTTACATTCAACTCGATAGTCCCAAGTTGTGCATAGGAGGCATCTCCAACAAAGATAAATGGTATAGAAGGGTTATGTTCTTGTT
GAGACATGGAACCCATGTGAGTCTTCATGAGTGGTTGATTGATTACCATGGTCCCTCTAGCCATCCCCATTGTCCAAATCTCTTGAATGGACAAGTAGCT
TCTATATTATGGGGTTACTCATCCTCGATTGGTCATTTTTATGCTTAGTTATATCTTAAGTGTGTGCTACTATGGCATGATGTTTTGATTGATTGTGCTA
ACTC

chr04 190,519,711 C T C
AGCCCAAAAGTCAAGCAAGA
TCCGTCAGTCCTAAATCCTTCTC
20
23
20
59.3
150
GAATCAAAAGAGACTAACAAACTACAATAAAGCAAGTGCGCCGGTTGGATTGAATAAACCAATGCAACAATCAAGAAGGCGATTAAGAAGACATGAGTTC
TCAAACTGTAGTATAAGTCTTTATCGCATATGTGAGCTTCCCCTCATCCTACTTCCCTCCACAAAGACAATAAGAGAAGGAAACCTCAAATAATAAAGAA
GATGCACTACAACCGCATACACATACCCTCTATACAAAGCAAGAAAGAAAGCAGTCCTCGCCTCGGGTAAGCCCAAAAGTCAAGCAAGAATCGACTTCA[
C/T]ACACTAAGAATATTATCATTATCTTTGAACGAGTTTAAAAGATCAAATAAGACGAAGGATTTTCCTTTTTTCATACTACGACATTGACTAAGCTAA
GAGAAGGATTTAGGACTGACGGAGAGACTGAGACAAGCACTATAGCACAAGGATTATCATTCTCTTGCCTCAAAGTTTCAAAGCAAAGAACCTTCTCCGC
TACTGTAACGACCAAAAATCTCCTCCCGGGATGTCACACGGTGCTTAAGGCTACAAATAGCCCCAAGCTAACCCTTGGAGCCTGTCACTACATAAAATAA
CTCA

chr04 200,000,034 A A G
GCGCTCACACTCATCCTCTT
TTCTGTAGCTTGGCTTGCCA
20
20
20
59.89
105
ATAGTGATGTGGACATAACTAGGCTTCTAACTCATGCTCAGCAAATAGAAGAGCATAAGATGAGGGAGAAGCAGAATAAGATAGCAAGAACAGGTAGTTT
CAACTTTGCTCAGCCAAAGTCAGAGAAAGAAAACTATTCTCAGTCTCATCCTAGGTCATCAAATCCAGCTTCTTCTTCAGCTTGTACTGGCATCAGAGAT
AGGACACCAATCTCTAAGTCTCAGGGCAGTGTTAGTAGCGCTCACACTCATCCTCTTTGCAAGACTTTTGGCAAGAACCATCAGGGTATTTGTAGAGTT[
A/G]GCAGTGATATCTATTTTGGATATGGCAAGCCAAGCTACAGAATTAGAGAGTGTCCGCAGACAGGTCCGCAGGGTTAGAAAAACTTTTCCACAGCTC
AGTTTGGTCTTCCAAATCAGTAGGGTGCCATCTCTAGTGCTACTAGTGGGCAACGCCCAAATAGACTTTATGATCTCCAATCCTGACAAGATTAGGAAAA
TTCTCCTGATGTGGTTACTGGTACATTACAGACCTTTCATGTACATGTTTATGCTTTGATAGATCTAGGAGCTTGCTTGTCTTTTGTTACTCCTTACATA
GCAG

chr05 8,000,510 G G A
GGCTAGGATCCCTGTCTTGC
GCCAGACTAGGCGTTCTCTT
20
20
20
59.47
115
TCCTACTCCACCAATAGATCTCCCGCAAGTCACGGTACATCTTAGTGGCCCCTGGATGAATAGAGTATCATGTACCATGCGCTTCTGCAAGAATTCGTTG
CCTTAAGTCATCTATACCTGGAACACACAGATGACCCTGACAGTGAAGAATACCATCTCCCCCTTAGGAGAAAACCTCTACTTTCTGATTCTGAACTGAC
TCTTTTAGCTTGACAAGGCTAGGATCCCTGTCTTGCTTTTCTTTCACCTCAAAAACTAGAGATGACTCTGAACTACTCTGAATACATATACCACCCTCT[
G/A]AAGAGTCAACTAAGAGAACGCCTAGTCTGGCAAGTTGATGGATCTCCTGAGCTATCTTCTTTTTGCTATCCTCAACGTGAAAAATACTACTCATGG
AAAGTATACTGAGAGCATCGACCATAATGTTGGCCTTGCCGGATGATAAAGGACACATGTCATAATCTTTCTAGATCTCTAACCACCTTCTTTGATGAAG
ATTAAGATATTTTTGAGAAAAGACATATTGGAGACTCTTATGATCTGTGAAGACATCTACATGAACTCCGTATAGATAATGCCTCCAAATCCTTAAGGTC
AAAA

chr05 20,000,030 C C T
TGCATGTTTTTGAGCCAGTCT
AGGACTCCCGCAAAGTTCAG
21
20
21
59.96
130
CTTGGGAGGACCACCAGTCCAACACACCTACAGGAAGCAAAATAGAGTGGTTGACTTGATGACTAAGAAAGGATCAGAGCTGGATCTTTTTGACAAACTT
CATGTTTTTGTTACTCCACCTGCTAGTGTAGGAGTAGTTTTTTGAGAGGATTTTGCTGGGAAAATGTAAAGTAGAACAGTGACCAACAACGAGACTATCA
ATCCCGATATGCATGTTTTTGAGCCAGTCTAGGTTGTTTGTATAAGTACCATAACTTTTATTCTAGGGATAATACTCACAAAAATACCTGAACTTTGAC[
C/T]GCATTTCCAGTTGAGCATACTGAACTTTGCGGGAGTCCTATTACCCCCTAAACTTTTTAAAGTGGATTTAATTTCATCCGAAATTCTATGCCCAGT
TTCGGCGGCTGGCGGTGTAATACACGCACCAATCTCATTTTTACACGTGTATTGACGCGTATAATACACGCGCTAACCTCATATTTACATGTGTCCAAGT
GGGCAGATATATGCCATTAAAATACAAAAAAAAAAGGTCTAGGAGGGTAATAGGACCCCCGCAAAGTTCAGTATGCTCAACTGAAAATTCGATCAAAGTT
CAGG

chr05 41,006,499 C T C
GGGACTAAGCTTCCCCTTCT
GAGGTTTAAGGCAGCCCAGA
20
20
20
59.67
148
GACCTTCTTTATTCTATAGTATACGAACTTGTCGATTAAGAGTTTCGACTATAATCTTCTCGTAGGAAAGACTGTTCTGAACTTCTATGTTCTCTAAGAG
AGCAACTACAACTGGGTCACTAATACACTTCTTCAACAAAGAGATATGGAATACTAGGTGCATACATGCTAACTTTGCAGGAAACTCAAGCTCATAAGCC
ACCTTTTCAAAATGGCTCAAAATCCTGTAAGGACCAGTAAATCGGGGACTAAGCTTCCCCTTCTTACCAAACCTCTTCACTTCCTTCATGGGAGAGATC[
C/T]TCAGATATATGAAATCACCAATCTCAAACTCAAGATCTTTCCTCCTCATATCTACATATGATTTTTGTCAGCTCTGGGCTGCCTTAAACCTCTCCC
TAATCAACTGTACTTTCTCTAAAGTATCAAACACCAAGTCAGGCCCTACTAAAGCAGTTTATCCTACTTCAAACCAACCAATCAGAGATCTACATATCCT
TTCATATAGAGCCTTAAACGGAGCCATCTGAATAATGGAATGATAGCTATTATTATACGCGAATTCAATCAAAAGAAAATGGTCATCCCAACTGCCCTTA
AAGT

chr05 59,000,045 A A C
CAAGGGCATTTGCAGAGCTG
GCGACTGGACTGAGCTGTAG
20
20
20
60.18
127
ATTTCAACTTTGCTCACCCCCAGTCAGATGGAGGAAACCGTTCACAGTTTTGCTCTAAGTTAGCCATTCCATCTCCTTCCTCTACTAGCATTATAGTTTC
AAAGTTCAAAGATGGTAATAGAAACAAAGCGCCAGGCTCTAAATCTCAGGGCAGTGTTAGCAGTACCCGAACAAATCCCCTTTGTCAGACTTGTAGTAAG
AACCACAAGGGCATTTGCAGAGCTGGTAGTGATGTCTATTTTGGTTATGGCAAGCCAGGCCATAGGATTAGGGAGTGTTTGCAGTTAAGTCTTCAGGGT[
A/C]AGCAAAATCATTCTACAGCTCAGTCCAGTCGCCCAAACCAGAAGGGTGCCATTTCCAGTGCTACTAGTGGGCAACACCCAAACAAATTCTATGCTC
TTCAGTCCCGGCAGGATCAAAAAAATTCTCCTGATGTCATTATGGGTACGTTACAGATTTTCCATGTTCATTTTTATGCTTTGCTAGACCTAGGTGCATC
TTTGTATTTTTTTACTCCATACATAGCAGGCGATTTCAGAATCAGTCCCAAAGTCCTAGCAGAGCCCTTCTCAGTCTTTACCTCAGTGGGTAAAACTATC
ATAG

chr05 63,000,938 C C T
AATCTTGCAGGTGGGTACGG
ACGAGTTAGGCCTAGGGAGT
20
20
20
59.37
134
AATCCCTCTTAAAAGCCCCAAATTGATTGACTTAAAGATACCCTAGCCTTTTCTTGAACCAAGAGTTTGAGAAAGATTTGAGAGAGTTTAGAGAGTGTAT
GATTGAGAATAATAGGTTAAGAAAGCCTAAAAAGGTGTTTTATGTCATGGGGTCCAAATGGGTTAAGAGGGAAAATGTCCAAAATACCCCCAACTTAAAC
TATAAAAATCTTGCAGGTGGGTACGGTTGGACCCCTCAACTCATATCCACACTATACGAGTGGTACCCTCCACTCGTAACTTGATCAGAAAGTTGAACA[
C/T]CACATTCTTTCCAATATATGACTCCCTAGGCCTAACTCGTACTATCACAATAAGACTAGTATCTTTCAAGTCGTACCCTAAGCAGGACATCTGGGC
TAGACACTAGACAACATACGATTGGGTACTATACTTCACGTATCATGAATATATGACTCGTTACCACCAATCCGTTACCATAATAAAAACCCAATCACCA
AATACTAGACACCTTATGAGTTGGGTCACTTGACCCGTACCAATACTATACAACTAGTAAGGTGAGTCGTATGATTATAAAAAAGCTTAAGACTTGAGAA
ACTT

chr05 78,001,953 C T C
AGGTAAGAGTAGAGTTGTTTGGGT
CAGGGTTTCAATTCTTGCCCA
24
21
24
59.03
99
ATTATGAGGAAATGCCAGTTGAAATCTTATATTGGATAGTTTATCGATTGTGGACTAAGGATATACCTTCGGTAAAGATTCTATAGAGGAACCAAAAGGT
TGAAGAGGCTACTTGGGAAGCCAAAGAGGACATGAATCCTAAGTATCCATCCCTATTCCATATTCCAAAAAATCGTGCTTAAGGTATGTGTTGTTCTTAA
CATCTTTGTTTTCTGTCTTTGTTAAAGGAAGATTGTCAATTCCTTGGTATTCTTTTTGTGTCTTAAAGGTAAGAGTAGAGTTGTTTGGGTTTTAATCGT[
C/T]AGAGACAATGACTTGTCCCATCATTCAAGGATGAATGATCCAAATGGGCAAGAATTGAAACCCTGTGGGGTATATGGGAATCCCCAAAGTGATTTC
AATAATAAAGTCTGCAGGGTACACGAGAATCCCCTAAGTCTTGGCTTAATGACATTGATTGCAAGTTATAGTCAGTATGACGATACCACTTATCATTGCC
TTAATAATTGACTTCTTATATTGGTGGCTGGTTATGTGTTAATTGTTTTAATTGTTCAATAATAGGGGTTGTGATAGCTAGCCATGAAGGTGTGAGTCCA
TAGA

chr05 97,001,642 C A C
CGTCAACCCTCGCTAGTAGG
TTCACCTGCCAGTAGAGGGT
20
20
20
60.18
142
TGTATTTGATAGTCCTAAATTCTGTGGAACTATACTGCATTCTATATTGAGATGAACGACTATATCTGATAGTCCTAAATTTGTAGAACTAAAATGAGTT
CTATTCCAAGACTGAGACTGTGGGAGGTAATCATCTAACTGATATGCCCTTCTCTAAACTAATTGGGGTCCAACCTGTAACCCCAGTCGGAAGGGTGTCA
ATACCGTGTCACGGGTAGAGATAAGCTGTGAGTTATTCTCTTTGACAGTAAGTTCTTTCGTCAACCCTCGCTAGTAGGAAAAACTCAAATAAGATATAT[
C/A]AACCCTAGTATCATAGGGATATATCTTAACCTATGATGGCTACGTAGTTCTGGAATATATGGATTGCTTCTAAGGACCACACCCTCTACTGGCAGG
TGAACCCCCATCCTTGGGTTTACTCGGTGCTGAATCCTACTCCTAACTGAATATACACTGGACTGTATTTTAAACTGTACTAGGCTGGACTAAACCGTTT
ACTGATTATACAGTTTGACTGAACTAAACTAAGTTTTGTGGACTGATGAAATACTACTGAATTTTGTTAACTGACTGAGTCTACTGAGGTCTGATCTGAG
TACT

chr05 110,501,688 C C T
TCTGAACCCAAATGCTACCC
GTCCATGGGTAGTGTTGCTCA
20
21
20
60
122
CCTACTCCACCAATAGATTTCTCCCAGATCATAGCACATCTTTGTGGCCCCAGGATGAATCGAGTAACCTGCACCATGTGCTTTTGAGAGAATTCACTGT
CTCATTTAATCAACACCTGACACATATAAACTACCCTGGCAACGCAACATACTATCTACCCATTGGGAGAAAATCTCTCTTTTCTGATCTTTGACTAACT
CCTTTAACTTCACCAGACTAAGATCCCTATCCTGCTTTTCTTCTACTTCGGCAACCAAAGAATATTTTGAACTATTCTGAACCCAAATGCTACCCACAG[
C/T]TGAATCAACCAAATAAACACCTAACATGGAAAGTTGATGAACTTCCTAAACTAGCTTCTTCTTATCATCTTCTACATGAGCAACACTACCCATGGA
CAAACTACTTAGGGAATTTGCCACTACATTGGCCTTGCTTGGGTGGTATAAAACACTCATATCATAGTCTTTCAACAACTCTAATCACCTTCTCTGACAC
ATATTCAAATCTTTCTATGAAAATACATAATATAAGCTTTTTTGATCTGTGAACACATCAATATGCACCCCATACAAATAGTTCCTCCAAATCTCTAAGG
CAAA

chr05 130,003,200 C A C
ACACAGAAAATGTATCAGGCA
ACCCAGAAGATTGAATCATCGGT
21
23
21
59.8
141
GTTACTACAGAAAAGGGAAAAATGATCAAATTACATCAAAAATAAAATTTTACAAATCAGATCATTACAATAATATAGACAAATAATATTAGTTATATCA
AGATTGAGAATATAAGTACATTTAAGAGTATGAAGAATATGTTTTTATTAGTTAGTCTAAAACAACTATCTCTACTCAGTCCTATTCAATACACAGAAAA
TGTATCAGGCATAATCACGATAAATTACATTTAATCTCTTTCTACAATCATTCTGATAGTTTTTTCTAATTTCCATCTATGGTCGAACTATAACTTTAA[
C/A]TTATAAGAACCGATGATTCAATCTTCTGGGTATAAACTTAAATTCTGTACACCAACTCATCTACTATATAAGTTGAGGAAAATATATGACAAAATA
ATCTATTTAATGTAATACTTCATTAAATAGAATAAATAAATAAATAATTATTCAATAAGTAATACTATATCAAAATGCATGGTTTATAGTATATCCTAAC
AATCTCCGATTTATGCTCATAACCATGTGCCTACAACTCTAATACCCATTATTTCTACATGCTTATCGAAAGGCTTTTGTGAAAGGGTTTGTCAGGTTAT
TTGT

chr05 149,014,757 T C T
TGCCTCAGAGGTGTCTTCCT
AGAGAGGAAAGGGAAATGGA
20
20
20
55.41
139
CAATAAATTTAATAATAAAAGCTCTGGACTGCTTAGAATTTCTTTCAACTTAGGTGGCCTCCCTTGTCCCACACATCCTTTATAATCATATTTTTATTTT
CCGTTTCAGACAATTATATTACTTTGTGATTTGACTAATCATTCTGGTATATTCTTGGAATACTGCAAGCTTCAAATGTCATGCTTATCATCTAATTGCT
ATTTCTAATTTTGCCTCAGAGGTGTCTTCCTCGGGATGGTTTGGAGGAGCACTTTGTCATACATATGGTAATATTCAACCTGATACTCATTGCCTAAGT[
T/C]GACTATTCTGGTTCCGATATATTCTTTTTTTCCATTTCCCTTTCCTCTCTTTCTTTTTTTTTTTTTTTTTTTTTTNNTTTTTTTTTTTTTTTTTTT
GAAAAAAATTGGTTGGATGTAGCTGGTTAAGAATATAAATTTGTCCTGGATAACAGTGCTTTTTAAGTACTTTGGCACAAAGTAAAGAAAATAAGTTAAA
TTCATATTTTTCAACATGATGTATTTCCTTTATCTGTCAACTTAGTATGCTTTGAATTTTGTATTGTCTTCTAAGGAAGAAAGGTGGTTTACCTTGTCTA
GTTT

chr05 153,502,567 G T G
GACCCTCATCATCCACTGCC
ACTCTTTTGGTCCCTGTGGC
20
20
20
60.18
93
GTGAGATTTCTCTCTCTGAGTGGCGGTACTTTAAGAACTATGGAGGTACTCATCTTCTCCTTTCTTCCTTTATCACTGAGTTATGTAGGAGAGTGAAAGT
GGAGGAATATACCACAGACACTTTGGTGTGCCCAGTCTCATTAATCTGTCTACTCAAATTCAGAGATTAAGGTGCACCAGGTCAGAGTAAGAAAAGGAAG
ATGGACTCGAGAAAATCAGTCCAAGAGGTCTCACACTCTTGTAGACCCTCATCATCCACTGCCTTCGATGATATATCTGTTCAGATGTAAGTAGTGAGA[
G/T]AAATATTTTCCAGACTGCCACAGGGACCAAAAGAGTCCTCCACTGCTCAACATTCGTATGTGGCATAGTCTAGTTATGATAAGTACATTGCAGAGA
AAACGAATCAGGGTGCCACAGTAGCCATCCTAGAGAGATCTTATTTAACCCTATCTATATCTCATAAGGACCTCAAATACTACATGAGAATATGGTGAAA
AAGCAAAAAAAAAAGATATGTTTTTTAGAAAGTTGTGGAAGGGGGTGAAAGGCATCTTTAAAGTGATCAAACCCAACCATCCACTACCTCACCGAGATTA
GATA

chr05 155,019,802 G G A
TCCAAGGGATCTGCCTGAAC
TCGTGTGAGTGAGCATGAGC
20
20
20
60.39
147
GATGATAGGAAGCTAACTCAGAAATCTCACTGGAAGTCACTCCCTTAATATCTATGACTTTTTACACCTGATCGAGGAACTCCTGTGGATCCTCTTAAAA
CATAGATCCTAAAAATAGGGAAGGATTTATTTGGGTGAAATCCCGAATCCTAGTTGTAGTAGTATTGGCCACTGGGTTGGCCTGAACAGTAGTTGGCCAT
TCATTCTGAGCTATTATAGAATGGGATAGAGTGGTGAACATAACTCTGAATTCTGCATGGGAGACATGCTCCTCCAAGGGATCTGCCTGAACGGGAGGA[
G/A]GTGCTGGCTAGTTTCCAGTTCTTCTTCCACTGGTCTTTTTGGGAGATATGTTCGATAAATAGAAGGAAGTAATAAATTAGACAAAAATTTTAACTT
TGAGCTCATGCTCACTCACACGACATGAATACTGAAAAAAGGAAAACTTTTCCTTAAAATGCCTCATAGCCTTTTCTCCATAATTGTGGCACACTTCACA
ACCATGTACAAGACTCTAATTGACGTGGCTTTCAGACTCCCTAGGACTCTCTTGAACCTTAGGATCTAATCTATATTTGTAATACCCCAAATCTGCACCC
CAGA

chr05 182,507,029 T C T
ACATCATGGGTTTACACGGT
CTAATGGCCTCGATCGAGCA
20
20
20
59.68
98
TTAAGCTAAGACTCACTAGCACGCCTTCAGCATAATATGAGCACATATATATTTTGTAAAGACTATTCAGCATAAAAAATGTATGGGTTTAGATAACACA
AGCTCCAAAATTACATTGCCATCATAGAATAGAATCATATTACATGTAGGGCGCCTCCTTTTTTAGCCAAAAAGAGGCTTAGTATGGATCCATAGCTCGG
ATAGATTCTATACCTCAACAAGCTGTAAAACAACTTTATCAATGTAGGTAAGACATTGAACATCATGGGTTTACACGGTATATGTTAATTAAAAAATAT[
T/C]CCAAATAAAAAAGTTTATTTATTTTTTTGATATTATATGCTCGATCGAGGCCATTAGTTTATAAATTTTTTTATGATGCATTAAATATAGATTATT
GAGTTTCAGTTGCATGATTTACTAGCAACTCAATTTCCAATTTTAAAAAAAGTTTTTACAATACTTCACTTCTAGTTCAACTCACATTTTAGTTATTCAG
TTGCCCATGATTTACGATTGTCAGCATGTTATTTAAAGTATGATTTATGGCATTACACCATTAATTTTTCAAGAATCTTTATAATCCTTTGTATTCTTTT
TTCA

chr05 186,501,594 C C T
TAGAGTGTCCGCTCGGGTAA
CCGAGTCCCGCTAAGTCAAA
20
20
20
59.75
142
CTAGAGTGTCTGCTCGGGTAAGCCAGTCTAGACACCTATCCCTATTAGGCTTAAACTTAGAAAAATTGAAAACTTCGAATCCGGTTATCCCTATTAGGTG
TCGCTTTATTTGCATCATATGCATTTGACTTAGCGGGACTCGGCACAGGGGTCGGGTCTATCTAGGACAGGTGACCTACTTTGGCATCCTACATGCTCTT
TGACAATTTTTTGGAAGGCTAGAGTGTCCGCTCGGGTAAGCCAGTCTAGACACCTATCCCTATTAGGCTTAAACTTAGAAAAATTGAAAACTCAGAATC[
C/T]GGTTATCCCTATTAGGTGCCGCTTTATTTGCATCATATGCATTTGACTTAGCGGGACTCGGCACAGGGGTCGGGTCTATCTAGGACAGGTGACCTA
CTTTGGCATCCTACATGCTCTTTGACAATTTTTTGGAAGGCTATTTATTTGTTGACCAACTTTAGGCAACTTTAAAATTTAAGAGATTAAATTATCCTCA
CATTTAGTGAATTATTTTTCAGAGAAAATTTTATTTTAAAAAGAAAGGAAAAATTTTAGTAACATAGTTTTACAGTCTTTATGAACTACGAGGGTCTGAT
TCTC

chr05 209,500,035 C C A
TCTGAAGGGTGTTGCATGGG
CAGCAGTCAGAATCACATTGCA
20
22
20
59.51
121
ATTCCTTCAGACTCATAGAATTACATAAAACAAGCATACAACAATCTTTCCTAACATAACATATTTACTTTCTCTCATCTACACAGTTATTCATCATCAT
TGTCTTGACCTAAGAAAAGGTCATTGAAAAGTTAGTGGAATACCAGGGCCTGAAATATGAAGGGATACTAAGCATAACTTGATACTTTACTGAGGCCTGA
GTAATAGATCATTCACGGCATGGATTCATTAAAGAGATTTAGTCTAAGGATGTACATGATACAAATCTGAAGGGTGTTGCATGGGTACTTGAAACTAAA[
C/A]ATACTATAAAGCATGAGTACATAAGTCATAAGCTGCATGACCTAAATTTGGATTTCATAACTTATGCAATGTGATTCTGACTGCTGAATGAACTAG
AACTCCTCATATTAGGAACTGGGAGAGTACATGATTCTTTATCATATGCATGAACATGAACTATAATCATGGAACTATAACATAAGGCATGAGTAGGTAT
TGGGATAACTGAAAATACTGAGATAAGAATGGGTTGAGCCTCATCCTCACTTTCTGATGTTCTATAACATGCTGGCATTACTACTAAAATCTGAGAGCCT
GACT

chr06 18,548 A C A
ACCCCCAGGACTCGATAACA
TGCTCATGTTCAAGTTTATGGCT
20
23
20
58.92
135
TGAGTTTTGTTATCTCACTGAGTTTACTAAGGTCTTAACTAAATACTGAATACTACTAAGATTTGAAGTGGACTTGACAGATACTGAGCTTACTGAGTTT
TCCTGAGTTCTATAACTAACTGAGTTCTACAGATCATGACTTGACTGAGAGTATCTTGAAACTGACACTGACTCTAGGAAATCATCTAAATTTTTGAGTA
TAAATACCCCCAGGACTCGATAACATGAATAACATAAGACATGACAATACTTGAATAACATGACAATAGTGAATCACTCACAATACAATCCATGAGGCA[
A/C]TTCATCAAGCACTTGAAAGCCATAAACTTGAACATGAGCAGAAATGCATAGTAGTGTATCATAATTTATTCACTAAGGCTTTTCATCAAACACTTA
GCATGCAATTACTTATACATAAATGGGAATCACTTGTCAACCTGCTATAATGGCACTATTGAACTCACATAGGCATTTTATCAAACATATGGGGAGCATA
CTTTGGTCATACAATAATCAATGCATCAAATTAACATGTTTACATCAATCAACATGCAACTTGAAGGATTTATCATGAACATCATGCAAATCATCTCATA
CTAT

chr06 26,500,089 G T G
GCAATCAGTTGGGTTACATGGG
AGATGGGTAATCTGATGCAACA
22
22
22
57.49
133
GCAAGACCCCCAGAAGAAGCACTAGGATCTTTTGCAGTTTGACTTTGGTCGTAAAAACCTTTAACATTAGACTGACCTTGCCTAACTTCTCTTCTTATGA
ATGTTGCTCCATCCAATTTCTTCTTTATTAACTCTACCGTTGGTTCTTCTTTTGTATGAACAAGATCCAGAGTAAGAAAATAAGTCATCCCCAGCTCATA
ATGGTAGGTACGATCTAAGGATGTACAACCTATAAAAAAGACAAGAGGAATTTAAACCATATAATAATAATTTGCAATCAGTTGGGTTACATGGGGCTC[
G/T]AGTTATGTTAACACAGCCAAATTATGCCACATATGATCTAGCTACTACAACAACTGATTTGTATATTAAAACAGATTCATAATATGTTGCATCAGA
TTACCCATCTATTGCATAATTTGCATTAGATGGGTAATCTGTTGAGTGGGGTTCAGAGACTAGCTCAACATATGGTTAATCTGTTGCAAATTATGGATCC
TCTATTGCAACAGATTACCCATTTGTTGCACCAGTTGCATTTGATGGGTAATTTAATGCAACAAATGACCCATCTGTTGCAACAGATGGAACATCTGTTT
TAAT

chr06 37,503,661 G A G
AGCCTACTCGCCTATCCTCA
GCATCAGTGGCCCTATGGTT
20
20
20
60.11
100
TCTGTCATACACAGACCTTCCTAGGAGATCTACAAAGCCATCCGCAATATATAGGGCCTAGACTGAGGGCCTAACAGTTTCCATAGAGCCTATTGAGGCA
CATATAGGAGATGTAGTTATTGATATTGATATAGAGATAGGGGATCAAAGACAGGCTCCAGATTTGAGTGCACAGGGCAAGGGGACACTAGTTATTTCTT
CATCAGCCTTGGCTTCAACTTCAGAGCTAGTTAGCGTATCTTTAGAGCCTACTCGCCTATCCTCAATAGCTCATGCTAAAACTAATATTACTAAATCCA[
G/A]AGAGTTCTTACAGAGCTTAGTAGACAACCATAGGGCCACTGATGCTCGATTGAGGGTTGTTAAGACAAAGATGACTACCCTCTATGAGTAAATAAG
ATCAAGGGTGCAGACCAGATTTGAGCAGGTAGAGGCCATATGGGAGGACACATAGAGAGCTGCATTGTCGGAGCTACGTGCTGACTTTTACATATATCTT
GATGTGTTTAAAAGATGAGTTACATCCTGATTCATAGAGATAAATATGCCGAATCTAGCCCAGATGATAGAGTATTTTGATATACTATGAGCAAAGATAC
ACTC

chr06 57,002,076 C C T
ACAAAAACAACACAAACCAGACT
GAGAGCACATCACCCCAACA
23
20
23
59.96
149
AAAACTTTCTTAACCTATCGCACTCCATCTTGTTGTACGTTTGAAATTCATCTAGCATGGGTGTAAGGTGGTGTACAGTTTGGGGTATTGGGGGTGGTCT
CCCATCCTTGTTGGACTTAAGATACCCGTTACGAGAAAGCCTTGGTTTGGGTTATGTTATTGTATTGGTCTAGTAAAGAGAAAAAACAAAAACAACACAA
ACCAGACTAAAATTAAATGGAAAACTGAACATATCTAAGTAATTGAATATAGATGAAAAATGAAACTGTGCTAGTACCAAGTACTAAAACTTGAAGATT[
C/T]AAGAGAAAGAAAAGTGTTGGGGTGATGTGCTCTCAGTAATGAATAGTATTGTGCTAGAGGTGGTTTAAATAGGGAGGGTGATGAATAGTGTGGTTA
ATGGGTGATGAATGTGATTTATGATTTGTGAGCGTAGGAGTTTCAATCGCTGAAGAAGGTGAAGTGGAATGGGTAATGTAGAACATGTGTATTAATTGAA
TTATAAATTGATAAGGGTTGGATCAAGTAAAAGGCTAGTTTTAAGATGAAATAACTGTTGGGTAGTTCTGGGATGGGTCAATTTTAAATAAAATAGGAAG
AATT

chr06 71,002,598 C C A
TGGGTTATAAATATTGCACATCTC
CCCAGTGGCCATGAATAGCA
24
20
24
60.11
117
AACCACTCATTTGGTTCTTGATTTCTTCCACTCTTCTCTTTAATCACCGATGCTTTTACTACAAGTTTCAGCTATATGAGACAGTGCGTCTATGAACCAG
CTTGACTGATATGTTTCATATTACTTTGTCAGTTTGTCAATCATCAAAACTACATTGTACCAAACGAATTCCCCCTTTTTGATGATGACAAACCTCTTGT
CTTTGTGTATTCAAACACCTTCACCTATAGGAACTAAAGTATAAAACACTAGAATAAAACAAGTTAGTCAATGGGTTATAAATATTGCACATCTCTTAT[
C/A]TTCCCTCTTTTGGCATCATCGAAAAAACATTTTTAATACAATAATATATTGGCCAAAGTGATTTGTTATGCTATTCATGGCCACTGGGCTATCACC
AAAACAATCAAACAAAGACTTTAGCCAACATACTAATGTATTAAAGAGAGAAAAAATATGATTTAATTTAGCAAAGATAACCATTCCATTTAACTGACAG
AGTATGTTCCACATTAAACCTAAGCTGGTATTAAACAAATCAAAACAACTGAGAACTAATCAAAAAAGAATGCGGTATAAAAGTGGGACATGGCTAAGGA
TACA

chr06 78,003,704 T T C
AGATGCAAGCTCAGCTCATT
ACTGGTAGGGATGAGCTGCT
20
20
20
60.33
126
TTGGATAAGTCAGTACGGTTATGCATTCATTCTCAGGACCCACGTGAATCTTCTCAGTAGTCCTAGTTATAATGCATGTGGCTTAAGTTACTTTATCTTA
GATAATGTTCATAGGTCTTAACTCATCTAACTGAATCTAAATCAGGTTATGATTTTCTTACTCAGCTGTCTTATACATACAAATTTTCATAGTTTGGTTT
CCATGTCCCCAGCTATGCACTCTAGCCGAAATCTCATGAAAGAATATAGCTATTCTAAGATGAACAAATCAGATAGATGCAAGCTCAGCTCATTTTGTG[
T/C]ATCATGCCTTAGTTTCAGATATTAGATAATTAATTATGAATCAATTCCTAGGTGCCTTGTGCATCACCTCAATTTTCCTTAGCAGCTCATCCCTAC
CAGTATTTCTCAAGGGACCTAGTGTCCAAAGGGAGAGATACGCTATATTCCCCCAAACTTCATGACATAAATATGCCGCTCTCTTCTTTTAACTAATCCA
GTTTGTAGTAGTGAGTACCCATAAGTTGATCCATTAGCTCTAATCATTGTCGTACGTGATGTACTCAAGGTACTCAGTTCAAATCACAATATTCAAATCT
TGTA

chr06 95,001,010 A A T
GCACTGTGTGACATCCAAGG
TGTGGCTTTCAAACTCTCTAGGA
20
23
20
59.35
95
TTGGGAACTTGTCCCATCAACTCCATATTCAGACGGTTCGAGGATTTTAGACTAGACTATTCAAGACAGATGTTTAGTTTTTTAATATTCCTATCAATAT
TCAGTATTTATTTTAGTATTTTGAGAACCTTATGGCATTTTCAGTTAGACTTCTACATATTATTTTCAGTATTATTATTTAGTGCTCACAATAGGTACTA
GTCATGGGTTAGTTTGTGATCCTTCGTTGTCATAAGCACTGTGTGACATCCAAGGTATAGAATTGGGGTGTTACAAACTTGGCATCAGATCCTAAGGTT[
A/T]ACCAGAGTCCTAGAGAGTTTGAAAGCCACATCAAGTAGAGTCTTATGCAAGTGTGTATAGTGCATCACACTTATGGACAAGATGCTATGAGGTATT
TTTAGGAAAACATTTCCCTTCTTTCAGTATTTATGTCATGCGAGTGAGCATAAGTGAAAGTTAAATTCTCTTTCTAATCTAATATTCCCCTCCATTTGTA
GTGATATTCCTCACAAAAAGACTGACAAAAGAAGAACTGCAAATAATCTAATACCTTCGCTCGTTCAGGTAGATCCCCTGGATGAGCACGTATCTGACAC
AGAA

chr06 122,503,253 C A C
TCAAACCCTACATGTTTTAATGTT
TGTGGGCATTTCATCAAACACT
24
22
24
59.04
150
AGTAGCCCTCTTTCAAGAACAAAAACCCTAGCCTTCAAAGTTCAAGATCAGAACTCAAGAACTCACCGTCAATATTCTCATGAATTCATCAACCCAGGTA
TGTTGAGTGTTCATCCAAGGGTTTTTTTCACCCATGGATTCCAAGTATCCAAGTTCTAATTTAACGTTGCGATCTTTACAAGTTATTATGAATTTAATTT
GTGATTTAACCATGAACTCCCATGAATTGTAATTATATACCATGTTTACATGAAATTGTTCTTGTTATCAAACCCTACATGTTTTAATGTTATTATTCA[
C/A]TGATTTAAATCATACTTAGTGATGTTGATGTTGAAATCATACTACTACTACAAGCTTTAAACTATTCCCATACTTAGCTTAAACTATGAATGTCAA
GTGTTTGATGAAATGCCCACAAGAATGAATTCTTAATAAATACTTTCACATTATATCCCCAAAGTTTTAGTACTATTTTATTACTATTGCTATCAAGTCC
TGTGGGTTATAAATACACAAAAACATAGCTTTTTACTTAGTCTTGGTATTTTTAGAATAGTTTCAGTATATGCTATGAGCATTATCAGTTCATCAGTTTA
ATAA

chr06 124,500,002 C C T
TGCACAACTGAAGCATGATTTCA
AGTAATCCCAGTCGTGCATT
23
20
23
56.92
125
AACTTATGAAGGATAAAATAATACTAAGTCTAAATAATTAGCTAGAACTTTGTAAGTTTGGGACCCCTTAGCAAGCTTAAAAGACTAAGTTGAGCTTACA
ATTTTGCAAAGTCTTACAATATCTCCCCTTGGGAATATTCTTCCTCGAATGAGACTGATTAAATTGAGAATACTGATACACTATACTTAGACACTGAATA
TGCACAACTGAAGCATGATTTCATGACTGACATTATTGATATACTGAATTATCATACTGAACATGCATATCTGATGCATGAGTACATAGCTGAACATGA[
C/T]TCATGAATGCACGACTGGGATTACTAATAAGCTGGGCTTATATACTGTACATGCATATCTGATGCATAAGTACATGATTGAACTGATTCATGAATG
CATGACTGAATATGCAACGATAATGGATACCAATTTTATAACTGTAACTGAACATGGACTAAGACAATCTAAGGAAGACTGTTACCTTAAGTTAGACTAC
TAATGAACCGAAGATCATTTATTAAACATATATGAACGTGAATCTGAGAACATAACTGAGACTGAAATGGGATACATAAACTGAATATCATGAACTGAAC
TGAT

chr06 142,000,158 C C T
AGAACTCATTCGCGAACCCA
AAACTCCTGGGTTCACGCTT
20
20
20
59.82
102
CTATTTCTTTTTTCATGTTTCAAATCATGCTATAGAAAGGTTCCCTAAGAAACTCATGTAGATTCTTATCATGCTCTACTTATTTCAACTCCACCTTACT
TTTAAGGTAACAGATATGGTGAAGCTTAAAGTCCTCGGGGTAAGGCTTTCTCAAACAGTCCCCGCAGATAGTTATGGGATTTCCCATAGGAACAAAAGTA
TCCTATCAGTTCCGTTATGTTCCAAAGTTGTACAGGTCTCATTTATGATAATGAGAACTCATTCGCGAACCCAAAATTTGATATGCCATCAGATCCCTT[
C/T]TCAGAATCCTATGATAGTATATGACCTAGAGTTAGAAGCGTGAACCCAGGAGTTTAGCAGTAGTAGAGTTAGGATAATTTTATCTAAATTGAGCAG
ATTATGTATTCATAGGGATAGTTATACCAAGGTAGACCAGTAGGCTTGAACAGTACAAGTAAGAATTTAAGATTATTGATCTAAAATTAAGTAGAAGGTG
TGGATGTGAATTAGGAGATGCAATATTAGTAGTATATGAAGAAACAAAAGTAGATGATGTATTTAGTAGTCAAACAGAGTGTAAGTATATAATGATAATT
GCAA

chr06 161,014,198 C T C
TCCAACCATTATCGCCCACT
AGAGGCTACCGCTACTGAGA
20
20
20
59.45
80
AAAAGTAAAATATGGGGTAGGACTACGCTACAAAAGGCGAAACACATCAATAGCCCCTTAAAGTTATCAACTTTCACTTAGGCGTCTTAACTATACATTG
TTCATTTTAAACACCCCAACTAGTGTCCTGCTGTGTCATTTTGATACTTTTTGCTAACATGGCAAAGTGAGTGAATTGCACTCACTAGTAACGTGTGAAA
GACTAATTTAGTCAATTTTTATTTTATTCTTCTCATTCTTTTTCATTTCCATTTCTCCAACCATTATCGCCCACTATTGCACCAAACTTAAACTCAAAT[
C/T]CGCTCTTCAATGATCTCTCAGTAGCGGTAGCCTCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCATCCAAAAGCTGCACATTCCT
CTATTTTTTTTTTATACCCATGTTTTGTTTTTAAAAAATCTCTCTGCTATGCTTTCAAGCCTTTTTATATGTTTTGAATTGAAAGTAATTTGAAGAATGA
AAGT

chr06 173,141,071 T C T
TACAAAACCAGGTCCCCGAC
TGACCTACTAGATCAACACCA
20
21
20
55.44
90
AAAATTAGCTTTGAATTTTTTTCTTCTTTTTTGATGCTTGGTAAATATCAACCAAGTATTTGGAAGTACAACAGTAATGCGCATAGTGTCCTTTTGCACC
GCATAAAAAATAAATACATGCTCTAGCCACTTCACGTTTCTCAACCTTTCGTTGTTCCTTTTGACGGGTCCTTTCCTTGTTGAATTATTAAAACTAGAAA
CATGATTTCTTTCTTGACCATAATCATGATCATGACCACGTCCATATACAAAACCAGGTCCCCGACCTTTTCCACGCCTAGCATGATTGGCGTACACCT[
T/C]ATTCACTTCTGAAAATGGTGTTGATCTAGTAGGTCAATTTTTATGATTTTTCATTAATAAATTATTATTTTATTTAGTCACAAGAAAATGAGAACT
CAGATCGAAATACTTTTTGAAATCTTTCTCTCGATATTGTTGTTGTAAAAGTACATTCGAGGCATGAAAGTTAGAGAGTATTTTTTCCATCATATCAACA
TCAGTAATAGTCTCTCCACATAGTTTTAACTACCAAAAACTTCTGAACACGGCAGAATTGTAATCATGCACAAACTTATAGTCTTGAAGCCTCAAATGCA
TTCA

chr06 174,535,816 G A G
GTAGGTGTTTTCGCTCCCCA
TGCCTACTCTGAACTGCTCG
20
20
20
59.47
133
TTTTGAAAGACTTTTTAGGATGAGTTGGGTACTCGGGTTGATCTTAGCATAGCATTTCACACCAGACTGATGGCCCATCAGAGTGGACTATCCAAGTTTT
GAAGGATGCTTTGCGCATGTGTGATAGATTTGGTGGCTAGTGGGAGCATTTTTTGGCTTTAGCAGAGTTTACATATAATAATACCTACCGTTCCAGTATT
GATATGGCTCCTTTTAAGAATTGTATGGTAGGTGTTTTCGCTCCCCAGTGGGTTGGTTTGATGTTTCTGAGGTGAGACCTTAAGGTACAGACTTTCTTC[
G/A]TGAGTCGTTGGTCAAAGTCTGGATCATTCAGGATGGACTTCGAGCAGTTCAGAGTAGGCAGAAGTGTTATGTTGATCGTAGACTTCATGCCTTGAG
ATTTGGTATTGGTGATCATGTTTTTCTTTGAGTTTTACCCATGAAAGGTGTGATGAGGTTTAGGGAGAGAGGCAACCTCAGCCCCAGGTATATTGGTCCA
CTTGAGATTCTTCGGACTGTTGGTGATGTGGCTTATGAGTTGGCTTTGTCTCCTGATCTATCAGTTGTTCATCCAGTTTTTTGTGTTTCTATGCTTTTAT
TGAT

chr06 175,502,955 A A T
CCCATAATGGCTCGTGTGGA
TGACCAGTCTGGACTTGGGT
20
20
20
60.4
80
TTTAGGCCACATAATTAGTAGGGCCGCGCTTACGTCCTAAGTGATGAATTATTTTTGATATTTTAAATTGAATAAGTAAAAATGAAAAATCATTTATAAT
ATAGTAAACAAATTAAAGTGAACCAAAAACTACAAATTCATCACTCATCTCGTGAGAAAAGTCCATGTAGGTTATTTCTATCTAGATTCTTAATTTATGG
TATGGTCTGAATTGTTTGTTTGGAAAATCACAAAACAATATTCTCTTTATTGGAATAAAATGACAACAACATATCCCATAATGGCTCGTGTGGATGGAC[
A/T]GCTTAACAACTAACTGGCCGGTCACGACTCACAAACCCAAGTCCAGACTGGTCAACTCACAACATATAGACTTATATTATAATCACATACATGCAT
GCATATACATACGTACAGCTCATCCCAGTACGGATTGTCTATGAGAAAGCTCATACTTGCTAGTTTCAAAATTGTCATCATTATACGAATCTTCACATGA
ATGGGGAACGAGTTATGGGTCAAGCTTAGAATTCTTGGTTCCTTTTTGTTGGTCAAATTAGAATGTTTAATTTGTTTGATAACAAGAAAGCAAATTTAAC
AACT

chr06 216,503,242 C T C
GGGTTGGCCTGAACATTTGC
AACCTCAACCTGCTGACACA
20
20
20
59.45
106
GTTGTAGGGACAGCTCCCTCACCTTTACCTTTCCTCCAAGCAACAACCCAGTCATAAGCAAGGTCTTTCAACCTATACACAGCTAACTCTACACTATGTT
CCTCAGATACATGCATCACTTGAGTAATCTTTCGCACCTCCTCTAAAAACAACAGTGGATCCTCATCAGACTTGGATCCATAGAATTTTGACGGATTCAT
CCACATGAAGTCACGAATCCTGGCAGCAGCTGAATCACCTCCCTATTTTTGTAGAGCCAGGGCTGGGTTGGCCTGAACATTTGCAGTAACAGCTTGGGC[
C/T]AGCGCCTGAAAGGCTGCCCGAAATTCAGCATGAGACACGTTTTTATTCAATGTGTCAGCAGGTTGAGGTTGTTGACCATTATTATTTCTTCTCACT
CGACGTGGAGACATATTTCTGAAAGAGGAGAGCACGAATCAATAGCAGAGAGAGACACTTTAAGCACGATAGACTTTTGAAAGAAAGAATCACACTTTTT
CCTAAAATGTCTTGTAGCCTCTTGCTCATAGATGTGGCGCGCTATACACCGATGATCAAGACTCTACTTAACGCGGCTTGTCAGACTCCCTAGGACACCT
TAAA

chr07 3,500,108 C C A
CCTCTCTTGGATAGGTTGACGT
AGCCAAAACCTCTGAGATCA
22
20
22
56.44
137
ATTGTCTAGAGGCTGAAAGAAATAATGTCATGCCAGTGGATTAGTCTGTTGAATTGGAAATGTTGAAGAGATCTCCAGATAGTGTGCTAGTAAGAGGGTA
GGAGACTGGTAATAGGAGGTTGTTTGGACTGGGTCATCTTATGGATAGTTTGTACTCCAAAATCTTTGAGGATGGGACACTCAAAGAAAATATGGGATTT
GTCCTCCTGGTGATGATTGCAGATAGAACAACTAGTATTTTGTCTTACTCCTCTCTTGGATAGGTTGACGTTATTGGGGAACCTATCATGCTAGCTTAA[
C/A]CAAAGAAAGGTTTTGACTTTTTAGGGGATTTAGACTTCCATATCTAGTTGAAATTAGAGGAGTAATTGATCTCAGAGGTTTTGGCTATATGATTAT
AAGAACTTCTGCTAGAGAACAGACAATTACCAGTGAGATTCTAAATGAGCTCATCAGTATAGGTTTTGGGATTGGGGAAAACAGAGTTGGTGAAAGTTTG
GATGAGATCCTCAGGGATTTTAATCGGAAGATCCTTGATATTCTAGTAGCCATTCCTCTAGACACTAGAGAGTTTAATGTCTTGGGAATGATAAGGAAGA
AGGG

chr07 6,000,192 C T C
TGATAGTGCACAAATAGGACCT
AACGACGTGACACCATGTGA
22
20
22
59.9
132
AACACAACTTGACTTTTTAATCTTCATTGCTGTTTTTTTATGATGCGGCTATTTCATTTTTCAATAATTATGTTCTTCGAACTAGTTTATTTGCCACCTC
AACTAATTTTACGCGATATTTGTCACCTCAAATACTACTCGAAAAATGACTTTTTTCTCAACATTCTTGCTTCCATTTAACCATGAGATAATACATAAAT
ATGACCCTAAACTTGATACCAAATTATAACTTTGATCTTAAACTTTGATAGTGCACAAATAGGACCTTTAACTATTCAAAACCTGAACAAATATGACCT[
C/T]CGATTTTGCAACCCCATGCTTGAGTTTCACTCGCGCCTACGTGGAAAGGTAATCCAATCACATGGTGTCACGTCGTTAAAAGGGCTGACTTGGAGG
GAGGTCATGTTTGTGCAGTTTTAAATAGTTAAAGGTCATATTTGTGCACTGTCAAAGTTTTATTTTTGTGTTAAAACGACGTTGTTGTTGTTGTTGTTGT
TGTTATTATTATTATTATTATTTATTTATTTCTATAGCAGCAACACCTAGCTTTTTTTAAAAATTTATTTTTTGTGTTAAAACGACGTCGTTATTATTAT
TATT

chr07 31,016,053 G G T
GGTGTACTCCAAGAGTGAGGC
ACTAGAAACAACAAGGCCCA
21
20
21
56.96
144
AGTATCATATTACTAGGATTGATGACCTATTTAATCAGCTTTATGGTGCTAAGTACTTTTCTAAGATCGACCTACAGTTAGGTAATCATCAGTTGAAGAT
TAGGGAGGTGGATATTCCTAAGACTGTTTTTCAAATCCGGTATGGTCATTTTGAGTTTTTGGTGGTGTCTTTCTCTTTGACTAATGCATCTACAATATTT
GTGAATCTTATAAATTGGGTTTTCCATTAGTTTCTAGATTTATTCATGATTGTGTTTATTGATGGTATTTTGGTGTACTCCAAGAGTGAGGCATATCTT[
G/T]TTGATCACCTCCGTAGAGTGTTGCAGACTCTCAACGATCAACGATTATATGCTAAATTTTCTAAGTGTGAGTCTGATGAAATATTAGTACTTTTTT
GGGCCTTGTTGTTTCTAGTAAGAGGATCATAGTGGATCTATAAAATATTGTGGTGGTTAAGAAATGGCCTAGACACATAATTCCAATTGATATTCAGAGC
TTTTTGGGTTTAGTCGGGTACTATAGGAGGTTTGTAGACATTTTCTCCTCTATTGCGGCCCCAATGAATAGGTTAACTTAGGAAAAAGTGATGCTCTTAT
GGTC

chr07 65,000,087 G A G
TGTGAACATTACCTTGTTTTGAA
AGCTGCACTTTTCTTTCTTCTTGT
23
24
23
59.6
150
GGTACACGAGTTTTATGCATCATACCGAGCTATAGTATTTCTTTCCATACAAAGATTGTCAGGCCTGATGAGACACATAGAGTAGCTACAACTTGATCAT
ATACTTATGGGAGGGGTCAGAGTTAATATTTCAGTAGAGACTATCCGTTGGGTCATTTTTGGTCCAGATTATATCACTTTTGCATCTACAACAGTGTGTG
ACTATAGATTGAGAGTTGATGAGTGATGATTTTACCACTCATTCTTACTAAAAATTTGTGAACATTACCTTGTTTTGAATAAATAAATAAGACATATTG[
G/A]TGATAAAATGCACTAATATCAACTCTTTAAAAGCATAGAGTTGATGAGATCAAAAGATGTGAATTAGAGCTAAAAATGATCAACAAGAAGAAAGAA
AAGTGCAGCTGAAGACTAGAGCAGAAAGGCCTCAGGTATTGCGGTTGCAGTCTACTGACCGCGATTGTGGTAGTCAAGGAAAATTCCTTTAATCGTGATT
ACAGAAGTTACCCATGGTTGTGTAAACGTGGTCGCAGCTAGACCCGCGCAATCGCAACTTAGCACAAGAAATTTGCCTAAGGGCAAAACTGGAAATGCAT
GTGG

chr07 66,002,588 G G A
CCCCAACCATTGATTTGGGC
TGCCACGTCATTTGACACTTG
20
21
20
59.67
107
CCGACATTACGATTATCCCAAAATAAGCAGCCAATCACACTAAAATATACTTAAAAATTCATACAATTTACTTAGTTAAATCGCAAGTCGCAAGCACACA
TAATCCCAAAATAATAAAATAATTTGTTTCACGTCTGTGGGCGATGAAATTTTGAAGATTTAAATCCACACAAAATTCAGATTATATTAAATTCAAAATA
TATTAGTCCCAAATAAATATTGCGGATTAATATAATTAGATTAATTATTTAAGTCCAAAAACATCCATTCCCCAACCATTGATTTGGGCTACAAATGAT[
G/A]AGCCCACTTTGCTAAGCTCAAGATATTGTCATATTCTACAGGCCTAAACAAAAGCCAAGTGTCAAATGACGTGGCATACCAAGTCAAGTAAATGAA
ACAATAGGACCATGCCACATGCCAAAATAATGCAGCAGGCTCAATAAAATCAAAGCTCATAAAAGGCGCCACGTCACTTGAATTTGATTGGTTAAAGGAA
GTCCATCTTCATTATGTCTCTTCCTTTTTCACAACTATAAATAGGGGTCTCATAATTCAGAAAGAGGGGCCCCAGAACTCTAACAAGTAGCAAGAGAAAG
CTCG

chr07 76,000,009 G G A
TCGTTTCGGTCCAGTTGGTC
AGTTCCCGCTGCTTCGTAAT
20
20
20
59.75
104
ACTTATTCGTATAGCTACATACATTGGGGCCCTTTCATTGATGACTGGTAATCCTACCACTCATTCATACAAAGTATACACACACTACCATGTTTTGTAT
TAGAAAATAAGGAACTATCCATATTTAAGTGCACTAACACCCATATTTTGCAGATATGAAGTGAAGAAGGTGAGCATATATGGAATGGAGCTAAAAGGGG
AGCAAATAGAAGCAAAAGGAGTGCAGCTAGAAACTTGAAGCAGTTAGCCTCGATTACCATGATCGTTTCGGTCCAGTTGGTCAGCAAAGAGTGGTCTCG[
G/A]AACCTAACCAAAATCGCATAGCCGCAGTTGCGATCAAACACATGCGATTACGAAGCAGCGGGAACTAGCCCAAGGGCTGAATTATCAAATGTTATG
GACGAATCCCAAATCATAAATAAGCAAAAACCCTTTCTTCTTTGGGTATTGCTTATCTCATAATATAGTTTTAAATTCTAAGCTTGAAATCCTAATTGGG
TAAATGTGTAATCAACTTTGGAGGCTTAAATTTCTTAGTTTATTGTTGAAGAATGAATGCTTTGGTTGACCCACATGGTATGCCTTTCTTTACTTTCTTC
ATGA

chr07 113,500,094 G G A
GGGTGTGATGAGGTTTGGGA
AGGGAAATGCTAACTCAAAAGCT
20
23
20
58.59
107
ATTTGTATGGTAGGTGTTTTCGCTCTATATTTTTTTTGTTTAAGGCTTTTTAAGGTTATACCTCAAGGTATGGACTTTCTTTGCGAGTTTTTGGATAGAG
ATCAGGTCATTTATGATAGACTTTGACTGACGCAAAGTAGGAAAAAGTGTTTTGCAAATCATAGATTCGTTCCTTGAGATTTGATGTGGGTAATCAAGAC
TTCCTTCTTATTTTACCCATAAAGGGTGTGATGAGGTTTGGGAATAGGGGAAATTTTAGCCCCAGGTATTTTGGACTATTTGAGATTCTTCAAACTTTT[
G/A]GAGATATAGCTTTTGAGTTAGCATTTCCCTTAGATTTATTAGTTGTTCATCAGTTTTTCATGTATCCATTCTATGGCTCTATTTTTGGATGAGTCT
CATGTCATTCATTTGGATTAGATGCAGTTAGATGAGAGCTTTTCCATTGTTAAGGAGCTAGTCTCCATCCTATATAGGGATGTTAGATAACTGCGTCCTA
GAGATATTTTGGTGGTAAAGGTCTAGTAGAGACATTGACTAGTAGATAAGGCTACTTGGGAGGTTGAGTTGAATATGTGTAGTAGTTATCCCTAGCATTT
TGTA

chr07 134,500,974 T C T
ACAAAATCATCATCGATACTCACT
TGATGACAAGAGTCTATGATGAC
24
23
24
55.6
101
AAATTTGATCCCATATGCCAATTGATGCAGAAAAGTAAATAACTCGTCACAGCCTCCCATACGACTCGAGAGCACACTCAAGAGAAGAATAAAGCAATCA
ACCAACATTATAGCTAACTGTCATCATCATTTAACCATCATCCCATAATCATCATCAATCGGTTATTTAGGATATTTCACAATTTACCAATATTTTACAA
TATGCCCATATTTAATAATGCTATCATCATTTAACAAAATCATCATCGATACTCACTAGTTATTGGTTTTTGAACTAACCATCTCTTATTAACTGATTG[
T/C]TTTGATTACTAGTCATCATAGACTCTTGTCATCATTTAACAACTATTCTCCATATATCCACTAATCATCATATATTAGATAACCATCTTTTATCAA
TTAACACCAATTTTCAACTAACATCATTTATTAACTAATCACTAATTACCAACGAATCCTTGTTTATCAACTAGTCATTATTAGTCACTTAACCATATCC
ATCACTATTCCATATTTATCTCTAATCATCAACTATACCACTTTATAAATATTAATCACTTACGGACTATAACTAAAATCACTAAGATCAACAACATACC
CAAA

chr07 135,004,575 G A G
AAAGACCATACTTCCCCGGC
GAGAGGGCTCAACTTTCGGG
20
20
20
60.39
89
CATATATTTTTTTTAATTTAGTAAACATCTAATCTTAAGATTGTGCAGGGCCATTGAAAAATTAAAAATGGGTCCCAAAAACAAACATAGGGTGGAAGGC
TCTATAGTAGAGGCATATTTTGCAAGAGAAACATCATTATTTTTTTTATACTACTTTCGTGATGAAGTTGCTTGTTCAAGAAACAGACCAAATCGTCATC
AAGACTATGAGAATAAGCCTTATTTACAATCGATATCAATTTCAATCAATCAGGTTGTAAGGCTAAAAAGACCATACTTCCCCGGCTCACTACCATGGA[
G/A]CACAAATCAACAACTTTGTATGTCTTGCTGAATTGCCCGAAAGTTGAGCCCTCTCTGAAGTAAGGAGATTAAAAATCAATGTATTTTATTTATTTG
CTTGTTCCCTTAAGGAAACTAATTGTGTTTAGCATGTTGGATCTTTAGTTCATTTAAGACTCAATTCCACAAAAATAAAGTGTATGCATCCGTTGCAACA
TGGTTTACATATGAGGTTCGTAAGTGTACTAATATTTCTATAAATTTTAAACATTTACACTTTCTTCAACTAACATATATATATATATGTATAATATATT
TAGG

chr07 144,001,196 C C A
GCCAAAGCAGTTTAACCAAAGG
TGGGGATTCTGTCGTGGTTG
22
20
22
59.96
143
GTACGTATAGATGGAAAGAATCCCTCAAAGGACTTAATTCACTCTATACCTTCGGATACTATACAATATTCATGCATTCATGATGGAAGTAGACACACAG
CTGAATCTTTAATAAGAAGGGGGTGGAATTAAGAAAGAATGGTACGTTCTACTCGCTCCAAACTCACAGAAAAAAGGTGAGGGTACTTGGCTCGCATATA
AGCTTCGGATTACCAAGTAGCACACTGAATAGATTCATTTTGCCAAAGCAGTTTAACCAAAGGAACTTCTTTGTTCCGTAGCCTACGGATCTGAAAATC[
C/A]AAAATCTCAACCGAAATCTCCTCGAATGAAAGGGTATCCTGAATATCAAAGATTTTGGAAGAATCAACCACGACAGAATCCCCAATACACTTCTTA
AGCATAGAAACATGGAATACCATATGAATGCTAGACAACTCCACGGGTAACTTCACCTCATATGCTACTTTCCCTAGATGGCTCAGAATCCTGTATGGAC
CAACATAACGGGGACTAAGCTTTCCCTTCTTCCTAAATTTCTTCACCTCTTTCATGGGTGAAACCTTCAAGTACACCAAATCATTAACATTAAACTCAAG
AGGT

chr07 152,001,534 G G T
GCATACCTGGCTAGCTGAGT
TGGGAGGAGTTTGCTACAACA
20
21
20
59.23
146
GAGCAAATTTAAAACTACCTGTCCTAGCTCTCTTATTCTCTCTTTCTTTGTCCTTAACCTTCTCGTCCTCAATCTGTTAAGCATAGACCATAATCCTAGA
CAAGTCTTTCTCTTTAATCAATATTATGGTCCTACACTCCTTGATCATACTATCAGATACATCAGACACAAAATTTCTTATCCTAGACCTATTATCATCC
ACTGTATGTGAAGCATACCTGGCTAGCTGAGTAAACTTAAGCAAATACTCCTTTACACTCAAATTTCCCTGCTTCAAATTAATGAACTCTAGCACCATA[
G/T]CTTCCCTCAACTCCAAAGGAAAAAATCTATCTAAAAATGTTGTAGCAAACTCCTCCCAATCTATAGGCCCTACATCTGCGCCTCTTTTCTCCTTCC
ACTGCTTATACCAAGTGTAAGCTATATCCTGCAACTGGTAAGCAGTCAATTCTTCACTCTCACTAAAGGTCATACCCATAATGTTTGTTACCTTCTGAAC
CATGTCGAGGAACTCTTATAGATCCTCATCAGACTTGGATCCCAAAAAAAAAGGAGAATTCATTCGGGTGAAGTCCCGAATTCTAGTTGCAGTGGTATTA
ACTT

chr07 167,008,438 C T C
TGCCCGGATGATATAGCACG
ATGGTGTCCATGTCGACGTC
20
20
20
60.11
138
ACTTCCAAAACTAAAGAGGATTCGGAACTGCTTTGCACTCCTATACTACCCTCAGCATCACCAAACAACCTAACCCTCAATCTAGCCAAACGATGTACCT
CGCGGGCCAACTCCTTCTTACCAATCTCCACATGTGCTACACTACCCATGGACTTTCGACTAAGGGCATCTGCTACTACATTGGCCTTGCCCGGATGATA
TAGCACGCTCATATCATAATCTTTCAATAGTTTTAACCATCGTCTCTACCTAAGATTCAACTCCTTTTGGGTGAATACATACTGCAAGCTCTTATGGTT[
C/T]GTGAAGACGTCGACATGGACACCATACAAATAATGTCTCTAGATTTTCAAAGCAAAAACCACGACAGCTAACTCAAGGTCATGGGTAGGATAATTT
TTCTCGTGAGGCTTTAGCTGCTTAGAAGCATAAGCTATAACCTTGCCCTTTTGCTTCAATACACAACTTAAACTAACTCTGGAAGCATCGTAATACACCA
CAAAACCATCAACAACGTCAGGCAAAGTCAACACAGGGGCTGAAGTGATTCGAGTCTTCAACCCCTGAAAACTCTTCTCGCAAGATTTGGACCACATAAA
CTTT

chr07 194,509,018 C T C
TCTTTAACCCGGCCAAGTGA
GAATGGGAGGGTGGTTTCCT
20
20
20
59.3
91
TTGCGTGTGAACAACACTGATGCACCCCATGGGGATACACTAAGATGAATAAACCCCTTATCCAGAAGATCCTTAAGGTTCTCCTTGAGTTCCCTCAACT
CAGTCGGAGCTATTCTATAAGAAGGAATAGATATTGGATGAGTTTTTAAAACTAAATCAATACCAAACTCTATTTCCCTATCCGGAGGAACACCGGGAAG
ATTATCTGAAAAGACCTCACAAAACTCATTTACTACCAGAACTGAATGAAAAGGACCCTTCAAGTTAAAATCTTTAACCCGGCCAAGTGATAAAGACAA[
C/T]CTTTGGAGATTAATCTCCAAATAAACCTCCTCCTAGGAGTTAGGAAACCACCCTCCCATTCTATAACTGGTTCATTAGGGAACCTAAAGACATCCA
TATAGGTTCGATAATCCAAGGACATGTAACAAGAGTGTAACCAATCCATCCCCAGAATAACGTCAAAATCTACCATATCTAGCTCAAACAAATCTAAGAA
GGTTTGTTTGCTACCAACAGATACCACACACCCCTATAGACTCTCCCAATAAAAACCAAGTACCTACCAGGATATAAATAAAAAAAGGATCCAAAACAAC
CTTA

chr07 206,002,988 T T A
TGAACTCTACCGTTGGGTCT
CCTACTGTTGATGGGTTGGGG
20
21
20
60.34
82
CGGTGTAGTGGGTGAGAGGGAACTGTGCAAGGGGTGTTTCCAAACATATTTATTTTTTTAAGTACCAACATGCTCATAATCACTACTGGCAGTAGTAGCA
GCATCAGGATGTCTGCCACCAGCATCAACATCTCCACTAACAACACCCTAGAAGAAGCAACTTGATCTGCTACAGTAGGTTAGTTGTGAAAAGCTTTAAC
ATTAGGATGACCTTGTCTAAATGCTCTTCTTATGGCTGTTGATCCAGCCAATTCCTTCTTTATGAACTCTACCGTTGGGTCTTCTTTTGTATTAAAAAG[
T/A]CCTAGAGTAATAAAAAAAGTCATCCCCAACCCATCAACAGTAGGAACAATCCAAGGATGCACAACCTATAAAAAAAGATCGGAGGCATTTAAATCA
TGTAATAATAATTTGAAGTAAGTTTGGTTACATGTTAACACAACCAACTTATGCAATAGACAATCTGGCTGCCACAATAACTAATCTGTATGTCGCAATA
GATTGAAAATATGTTGCATTAGATTATCTATCTATTGCATAATTTAAAGTAGATGGGTAATCTATTGAGTAGTGTTCAGAGAACCAAAGCAATAGATGGT
TAAT

chr07 218,000,144 T T A
ACGAGGCAGGGGATTTCATG
AGTTGACAGAATTTTCTTTTCGT
20
23
20
55.3
134
AATAAATGATGAAACGAGATTTCGAAAAGTATTAATGGAGTAAGGATCAACAACAATAACAAACCTAAAGAAATTTCATAAATAAGGTAGGAAAAATGGC
GGAATGTAAGCCGATTTTATCACTAACTCGTGAATAATGGAGAAAGAATATGGTTGGAATTGATAGTGTTTTTATGATGTGGAATAATTGAAGAACCGAA
AATCGAAATATTGATGAGTCCACTTTAATACGAGGAAAGGGAAAAAAGACGAGGCAGGGGATTTCATGATGTTCGTTCAGACGTCATTGAGTACTTTAA[
T/A]ATTGTAAAATTAAAAAATACATTTTAAAATATTAATTAAAGTTAATATTGTTCAACTCTACGAAAAGAAAATTCTGTCAACTAATAAAAGATGGAG
AAACTAATTGACAATTTTACCCTCTTGGCAAAACGAAAGTAAAATGGAGTAGAATTTGTCATCTTCGAACAAGAAGAAGCTATAGCTAATTTAATTTTTG
AAAATAAAAGTTAATCTTTTTATCATTCATTTTTATTTTATTGAGCAATACATCACACCTAAAGTGCAATTATTGGATAGCTCTTGTGGTTGAAATAAGG
TTGA

chr08 9,002,925 G T G
AGATGGGCTGACGATTCAAA
AAATACCCTGGGTTGCCTCC
20
20
20
59.66
148
TGAGGAGGAAAATTCCTACATTTTGGAGTTTGTCATGCCGAAAGGGTATAATACAACCCCAATCTTGAAGGCCAAGAATCTTAAAGATCGATGTCCATTT
AGTGGATTTTTAAGATTCTCACCGTTGTCAAACGAGCCCACCCTAAAGTTCAGTGCAAGATTGGGTAAGCAGTTCAAGTCTTTGAAGTGGCATGATAGAA
CTTTCCTTATCATGCTCTCACATTTTCCTAACGTACCTAAAAGATGTAAAGATCTAAAGATGGGCTGACGATTCAAATCGTCTGAGTGGAGATATAAAG[
G/T]ATGAAGCACTCTTAAGATATCCTGATGAATTTTGAGTAGTGAAGATAACCTAGTCATACCGCAACATTAAATCAGGCGCTGCTTGGGAGGCAACCC
AGGGTATTTTGTTGTTTGTATTCGTATTATATGATTGACATTAGATATTCACACCCATGGTGCCATAAGTATATTTCTAACTCTCTTGTTTTGGTTTGAC
GTATTGGGGACATTACATGATTTTAAGTTGAGGGTGGGGCTACTTGTGGGTGTTGATGCCCTCTTGGGGTGTTTGTTGCCGTGACTCTTTTTCCCGAAGT
CTTT

chr08 19,001,996 A A G
TCTCCCTCTCCCAGATGCAA
CTTCTCTAATCGGCAGCCCA
20
20
20
59.53
124
GCAGTGGGAGTTCTATCGTCAGAGCATGTCGATTCTGAGATTGATGGGCAAACCTTACTGAGGCTATCCATCACGATGTCCTGAGTTGAGTGATTGAAAC
AGTACGCAGCAACAACCTAAAATGCATCCAGGCACTTACTAAGTCAACAACAGTCCCAACACATGGAAAATAACCACTTGAAAAAGGTAATTATTTCCAA
GTCTGACCAGAGAAGGGGCATACAGACTAAAAGTATGCAGAAGAAACCATTAGTTTAGACATGCTAAGTTCTCCCTCTCCCAGATGCAATGGTCAAGTT[
A/G]TAATTTGAGAACTCTTTCAACTGTGAAGAAAAAAGGAGAACTCCCATATGCTGCTGAAATTCATGAACTTATATGGGCTGCCGATTAGAGAAGCGT
ATTATATAATACGCAAACCTCAATTCCAAGCGGGCTATGTTTAAAAGTTAAAACAATCCAGTGAAACTATTTTTGTTGCGCTTGTATACATATTTTTTTG
AAATGTGGCTTTACTGAGCATGTGTCTCCCAAATTTACATACAACTGGGATAGATTAGGTCTATGGAAACCCAAAAGAGCTAAAATTAAATTAGCTATCT
CCGC

chr08 22,002,391 G C G
TGACCTTGCCAGTGTTTTGT
ACCCAAAATCACCTCCCAGG
20
20
20
59.59
127
AGTGGTGAGTCCTTATGATTCAAGGACCTATCTTCCGACATTTCAATATTTGAGTGTTTTTGTTATTACTTTTAGTTTAGTTTGAGTCAGTTGGGGACCT
GTCCCAACGATTCTCGAGTTCATGGAGTAGTAGAGGCTTTGTCAGACTAGTTATTAGACTGTGGTTGTGTTGATATTTCCATTATTGTGGTCATTTGGAC
CGAGTATTACCTCTATATTTCCTTTCATTTCATATGACCTTGCCAGTGTTTTGTATACTTCTTCTTAAGTGTGTTAATATGAGAAATGATAGGTTCAAA[
G/C]GGTTAGCGAGGCTACTTGTAGACCTAAGCACTTTATAACGTCCTGGGAGGTGATTTTGGGTTGTTACAAACTTGTTATTAGAGCCTAATGTTCTAA
AGAGTCCTAGCAAGTATGATAAACCGCGTTGAGTAGAGTCTTGATCAACGGTGTGTAGCACGCTACAATTATGAGCAATAGGCTACAAGTTATTTTAGGA
AAAAGTTATTTCTTTCTTTCATATTCCATTGTGCCTATAGATGTCTCTCTTATCTAGTGATTTATGCTCTCCTATTTAAAAAAATGCCTCTTCGATGAGC
GAAT

chr08 30,039,994 A G A
AGGAATGGAACTATTCATGGCA
TGACAAGGGCATGCTATTCAC
22
21
22
58.63
127
ACATGGCTTGACTGAGAGTATCGTGAAAACTGACATGGCTCTAGGCACACAGCTAAATTATTGGGTATTAAATACCCCCAGGACTCGATAGCATGAAACT
GACAAGACTTGAAACTTCTTGAACACATGATCAACACCATGAATACAATAGTTTAGGGATTTCGTGTAGCACATGGTCATCATAATATTGTACATGGATA
GGAATGGAACTATTCATGGCATTATTTCATACTTCCAATCTCATGAATATTTTATCAAGCAATTAGAATATATAACAATAACATGGAGGGTCATGTTGA[
A/G]CATGAGTGAATAGCATGCCCTTGTCATTTAAGTCACAATTGAGTCATAATACATGATTTCTACTCTACTAGGCAATTTATCAAACACCTGGCATGC
ACAAATTAGGGCATAGGTATGATCCTCAATTTATCAATTCAAACCAAATTCAATTCATGGATTTCAACTAACATGCCATCCTAGTTTCATAAAATCATAT
AAAGATTCTAACTTGGGAATCATTCAACACATAAATATGATCAAAATCAATTCATAATATGAACATCATGTTATATTGTTTTAAAATAGGATTCTTGAGC
TTCA

chr08 35,505,294 C T C
ACCCCTAAGTTAGCCAGCCT
TGAGCCTTCACTACCATCGAG
20
21
20
59.25
139
ATTCTTTCCTATAACTCATCAATATCAGGAACGCACAACTTTCTTTGATACCTCAACATACTATCTACCCTAATCTCGAAAGCCATAACCTTTTACTGAC
CCACATCATCAATAATCTACATAAGTATGGGATCCAAAGCCTGCTTCTCCTTTACCTCAGGACCAAAAAATGATTTTAACCAACTTTCTGAGCAATCTTT
CCTCCATCCTCAGAGTCCAAAAGACGAACCCCTAAGTTAGCCAGCCTATGAATATCCTTCACCAATCCAATTTTCTCCTCATCAACATAAGACAAGCTC[
C/T]CCATAGACAACCTGCTAAGAGCATCAATAATAACATTAGATTTAACTCGATGGTAGTGAAGGCTCATGTCAAAATCCTTAAGCAGTTTGAGCCACC
GCCCCTACCTAAGATTCAATTCCTTCTACGTAAACACATATTGCAAGATCTTATGGTCTAAATAGATATCTATATGTACTCCGTACAGATAATGGTGCTA
GATTTTCAAAGCAAAGACCATAACCGCCAACTCTAGATCATGAGTTAGATGATTCTTCTCATGAAACTTAAGCTGCCTGGAAGTATAGGCTACAACATTA
CCAT

chr08 40,513,174 A A C
ACGAGTCTCTCTCTCTCTCTCT
ATCCTTCTTCGAGGCTGGGA
22
20
22
60.33
150
CCACTTTTCCTAACATTAAAATTGATTCTTTGAAAATAGAAATTGTATCACCCTTATTATGGAATTATGACTTTTTAAACTAGAAGTATTACTTTAAAAA
TTAGATAGATGTTGATTATGATCCATTCTTGATCCACTCATTTACTACTCCTTATTCACTTTGGTTAAGAGAGATTCAGACATTACTTTGCCATTTTAGT
CTTGAAGTTGATCACAGATAATGAATATACATATATTCACTCATTTAGTTTCGGTTTGAGTCTGGCATTTCTTACGAGTCTCTCTCTCTCTCTCTCTCT[
A/C]TATATATATATCCAATATTAGATAGTGAAGATTGATTATGGTTGTTATTGGAAGTCCTATATACAGATATCCCAAGTCTTTTATGCCATCTTTAGT
TTATAAGTCCCAGCCTCGAAGAAGGATGGTCGTCGTAGGTCCTACCTTTACGATCTACTAAGATGAAAGAGGTATATACACTTGGTAATTTATGACATGT
GACTGGTTGATGGTACTGGATTATACTTGCATTCATTATATCATATGCATTGTCGGTCACTAGTATAATTGTTTGGCGCTTATATCTATCAATTTTATGG
GGGG

chr08 54,519,648 C T C
TGCATCAACAAGTATTGCTAAGGA
GTGGAAGTTGCATGGAAAGGT
24
21
24
59.04
141
TAGTCATGATCTCTGATGGAAAAATTACATTCATGTACCATATCTAAGACAAAAGTGCATGCTTACCTTATTTCACCAAATACCCTGGAGGTGTCCTATT
ACTGGTACACTCCACATTACTTACTATAGTATCATAACAAATGCAGAATAATGATAACAGCACTTGTAGTAACCTCGTGATTTATATAAAGATTCATTGA
AATGTGATCACACTTATATAATCCAAATAAGTTTTTTTAACATTTTTCATTCCTTAACATATGCATCAACAAGTATTGCTAAGGAACAATTAATATGCA[
C/T]ACATAACACAAGTTCGATTAAACTACATAACAACCTCCTACCTCAATCCAATCTTGAACCACTCAACTATACTTGAACCTTACCTTTCCATGCAAC
TTCCACTTGATTTTGGTTTAGCAACACAAATAAACCACACAATAAACCTAATGACCTATAATGTTGAGGATTATACCCAATCCCAACCCCTAAGGCCAAG
TTCATGATATTCCTACCACTTACTAGGGCTTTTCTACCATAATTTATCTAAAACCTAACAATTCATTATTACCTTAGAGAATTTACAACATGCAAGGTAA
ATTA

chr08 57,015,759 C C T
TTTAGTTGGGGTGGGTGTGG
ATGCTAGTCTATCCCAGCGT
20
20
20
58
97
ATAAAACCAAGACTTTGAAATCCTTTGAACCAGTGCTAGTTCAAAGGATGATGATAATTATGGCACTAATTCACCCATGGAGACTAAGAGAACCTGAGCT
TGTTCGAGATGACATAATTAAGAGAAAAAAATTAAGGTTCAAGGATAGCGTCCGATGGAAAGTGAAGAGGCAGATAAACTCTATCAAGATGTTCTTTTCT
CAAGTATAAAGCATGGTATCAAGAGATCTTTAGTTGGGGTGGGTGTGGATAATTTCTTTTTAGATAGCAAATTATCCTGAGATTGAGCATTGATTCAAT[
C/T]ACTATACGCTGGGATAGACTAGCATAGTGCCTGGAAAGTATTATCCAGCTATGGTTTATGAGTTATACACTAACTATATGGTTACTCTAGAGAGAA
GCTATAGTAATATTATATGTTGTGAAGCAGATGTGGGACCAAGCTTGAGGTTCCAGAATCAGGCATATGAAAGGGTATTGATGTGTTGTGGAAATATGGC
ACATTAAATGCTTAAAATAATGAAATTATGCATTAAGGTAGGTCTTTTTGTCGTATATGATGTGAGTTTTATGTGTTTTGAAAGGAAAGCTAGGTCGAAA
GTGG

chr08 60,006,329 C T C
TGAGAATCCCATCCAAACCCT
AGGAACTTGGTTCTTGAAGAAA
21
22
21
55.76
140
TGACATTTCTGACGATGTCATCATCCTTAGGAAGAAAATCATAAAATTTGACCGTTTTGTGATGACATTTCGTGACGGCCTATCACGGGTCTGACGGCCT
ATCACGGATGTCGTCAACTATTTTTTCCAGTAATTTAGAGACGTTTTTGCAAGGGTATTTTGGTCTTTTCCCATCTTTTGGATGCCTCTATAAATATGAG
AATCCCATCCAAACCCTAATTTCATCATTTTTTCTTCTAATTCTATTGAGATAATATATCTAGGGTTATATCAAGAACATAAATCTTTCAAGGATCATC[
C/T]ATGAATCTTCAAAATTTCTTCAAGAACCAAGTTCCTTATAGTGTGGGCTTCAAGAATTATTTATTTCAGGTGTGGATAAAGTTTCAAGCACTAAAT
TTCATCCAATTTCAAAGATTAAGGTATGTGGGGTTTTGAACAAGAACACTTCTTTCGTTCTTGTGCCCAAAGATTTAATTTCTATTGAATTTCATGAATT
TTACAAAGTGGGTTTACACCCAAATTACTTTATCAAGGATTTATGAGATTTGAGCTATACAAGATTGACACATATGACTACTTCATTGTCTTATTTCTTA
AATT

chr08 83,505,719 G A G
AGTTCTGCCACTCTGAGTGC
AACCGTGCACTCACATGACT
20
20
20
59.89
114
CATCTTCTCATTTCATTGCTTGAGGTACCTATTTGATGCAACCAAGGATGAATAAGCTCTCTCTAAGCTGGCAACTGTAGATCTTTGCTTCTTCTGCTCC
TCTCAGTATATCTAATAATCAGAATGAGATACCTATGAATGACGATCAATTGAGGTCTCTCTCAGACCCTAAGGTAATTTGGACAATAGCCCTTTAACCA
CCTGCATCTGACCTCCATTATTTTTAAAGTTCTGCCACTCTGAGTGCGCAATCTCACCCACGTTTAAAGCAATGACAGAGAGAATGCAAGCAACCATCC[
G/A]TGATCACAAATCTATGATAATAGTCATGTGAGTGCACGGTTATACTCTATTGAAGATAATATTCATCAAAAGCCAACCTCATCTATAATGTCATTC
ATCAAATTATCTTTCTTGGTAGTGGAACAAAGTACTTAATAGCCCAAAAATAATATGCTTTCCATCCAGGTCCTTGGCTCCCATTCTTTGGCTTAAAACT
GCTCCATGTCAGCATCCGAGAGACCATACATCTCATTAATCTGCTAAGATATGAAATTGACTTGCTTACCCCAAATCGTCATCACCAGATTTGTGAGAGA
AACT

chr08 99,502,342 C C T
ACCTTTTGGCATTCCTCGGT
GTACACCCTGGGCATCACAA
20
20
20
59.96
139
AGATTTTCCAGACTATAAACCATAGCAGTGGCGAGTCCTCATCTTTTGAGGTCATGATTTATTTAGTTCAAATTAATTTATTAGTTTTAGTTATTTCAAA
TAAGTCAGATTTAATTGGGGTTTTGTCTCATCATCTCCTCAGTCAGTTAGTAAAGGCTTTTAAGACTATTTCAGACAGTTATTTAGTTTCTCAAATTTCA
GTTGCCATTGTTAGACATTTTATCAGTATTATGAGTTATGCCTTATAGAATTTATCAGATTTATGACTTTAAACCTTTTGGCATTCCTCGGTTAAATTC[
C/T]GCATATTTTATGTCATTTTTAGTTTTACTCAGTGCTCATAACAGGTAAAACCTTATGGGTTAGCTTGTGGTTCCTCGGGACTGTAAGCGTCTTGTG
ATGCCCAGGGTGTACTTTTGGGGCATTACAGTTAATTTAAATAGCTAAGAAATCAATAAAAACCATAGGACCATAAATATTATACCCAAAAGCAATCATA
TATAGAATCCATCTACTAAATAAACAATTAAAAGGAACAAAAAAATACAAAATTGAGCCACTCGATCCACTACTAAAAGAAAACAACTATGAAAGTATCT
ATAC

chr08 100,503,132 C C A
ACCAATCAAACCACCAAGGGT
ACAGGTTGATGGTGATTTGACT
21
22
21
57.9
124
ATTCATATTTTGGGACTCTAACCAGTTCAACCATTTTAAGCCATCAAGGCCACAATTTAGCATCATACATGACTAAAAGGTCTCCATGAATCATATATCA
ATCAATTACTTTAATAATCTACTACATTAGTTTCAAATATCATTTAAGTCAAATTTTGGTCACCAAGACCTTTATGAAATTACTCATTAGCACTCTTACA
CCAAGCTTTAGTTCAAATATAATTTGATTCCATGTTAGGCACTCTAACCCCTTTGTAACCAATCAAACCACCAAGGGTACCATTTAACTTATTACATGG[
C/A]CAAAAAGGCCTTTACAAGATCATTTACTAATCACTCTTACTTATTAAGCCATTGTATTAAGTCAAATCACCATCAACCTGTAACTAGTTATTTCGT
GTAGGCATTTTCATAAACACCTTGAAGGCACACTCTTACCATGACCAAAACCTAAGTGAAAACCATAAATATTAGGTTTAATCTTAACCCATTTATTAAA
TCACAATTAACAATCACCCACATGTGCAAACCATCACTAAAAACATGTAAACTCACAAGTTTAAACAAGAGAAAACATCACCCATCACTATATATAACAA
CCCT

chr08 111,000,001 T C T
AGATGGTGGGAACTCAGGGT
CCTGAAAGTGTAAAACCCACTGC
20
23
20
60.24
145
AAAGAGGTAGATTCTATGTTTAGTAAGGGAAGCATGTTGTTAAGAAGGGTGTAAGTATGTGATGAGTGCTAAAGCTAAGAAAAGTTAAGTATAGTATATA
ATAAGGGAGTGTTCAAGGATGAAGTTAGTATAGTTCATTAGAAGTTTGGGAATATCCATGTTAAGTGTTAGAATCTAAGTTGAATCTGGGAAGATTGAGC
TAACAGAAAGAAAAGTTGAAGCTCTAGATGGTGGGAACTCAGGGTATTGTGATGCTCAGAAGATTCTAAGTTAGTAAGTGTTCAAGTTATTATATGATG[
T/C]CATTGGGGCTATAGAAAGTTAAGAGTTCTATCTTAGAAGAAGTATTAGCAGTGGGTTTTACACTTTCAGGTGTAGTCTTTCAGGGTGTATTATTTA
TGTGTATTATTATATCTTGGACCCTAGAGTAATGTAGTTACCGTTCAGCTTAGAATTTATTAAGGGTCCACAGAATTAGAATGATAGCAAAAAGCTAAGG
AGGAGATGATAGAATAAGAAACCAAGTCAGGCTTTTAGATTCTAGTAGTGATGTCAGTGTGTTGTAGAACATTAGTAAGGGAGGAAGGTGCTCGACCCAT
TCTT

chr08 113,503,820 C T C
TTTTAATTCAAAGCGGGGCT
TTTTGTCCCTTGCAATTATATGTT
20
24
20
55.56
107
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGAGCTAAAATATTTTTTTAAGAGTTTAAAGTATTGAATGTTTGTGTTTGAA
AAATATAATTATATATTAAAAGATTATTTATTTCTTCATGGTTACATTAAGATTTCGTATCATTAATTTTTTTTTTTAATTCAAAGCGGGGCTAATCAG[
C/T]CGATTTATTTATTTGAAAGACAAAATAAGATTGTTGATTAAGGGTAAAATTGGAATAACATATAATTGCAAGGGACAAAATAGTAATTTACATAGT
CAACTTAAAATTTCAAAAAAAATAAGCACCTACTTGGCTACTTCTTGATTTTGGCTTAAAAAAAGTCAAAATCAACTTATTTTAAGCAACTTATAACTTC
ATCAAATACCATTATAAACAACAAAGTGCTTATAAGTTGTTTTGACCAAGTTAGAAGCACACCCAAACACCCTCTTAGTGAGCAAATAAAATAAATATGG
TAAA

chr08 120,500,146 A G A
TCAAGTTGCTGAGTCTAGTGT
TGTATCTGGAATCCAAAGTCCT
21
22
21
56.52
149
GGTTATGGTCATAGACTTTGTCTAATGTCTTTAAATTTTTATTACTTTATCATGTTATATGTTCGAAAATCATTTAACATGGGGTATAGGGTGTTTAATG
GTCTGGGTATTAGGGGTGGTCTCTGGTCTTGGTTGGAATTGAGATACCTGACATGACTAGGCCCTGATTTGGGTTATATCTTATAGCTGCTACAGATGTT
GGGGTTATCAAGTTGCTGAGTCTAGTGTAGACATTGCCTATAATTTTGACCATATATATGCTTGAGAATTTCTTGGTATGAATGTTAGGTTTTGTTTAG[
A/G]GGGTGGCTATTAATTTGATTAGATATGCTATATTAGGACTTTGGATTCCAGATACAAACTTGACTACACACTCTCTTAGTATTATGAGATATTTCA
AAGAATTTCTCCATATCCTATGACCTTACCTTTTATGCCCAGGGTGGATCAAAGTAGATTTGTAGAGTTAATAAAGGGAAATCCTTTTTGGTTCAAAAGT
TGTCCTAGGCTCGATGCTTATATGTTCTTACTTAGTTACTAATAGAGGTTGCAGAAGTTGGGTGTGATGAATTCTAATGGAGTAGATTTCACTTCCTTTC
AATT

chr09 41,508,169 C C G
GTGACATGAAATCCTTTCCATGCA
ATACCCCCAGGACTCGATGG
24
20
24
60.47
150
AAAACCTATGCTCCAAAGTGTGCATGCAAGGTGTTTGTTAAATTACCTAGAATGCTAAAAATCATGTTCCCATGACCCCATAGTATTTTAATGACGAGCT
ATGTCAACTCTTAAGATGATTCCACATGAACTTCCATGTTATTGATATGTGTTGCTAGTATGATTATGCAATGAACATGATATTAAGGTTGTGCAAGTAC
TTCCATGTGACATGAAATCCTTTCCATGCAATACATTATTGATAACCATGCTTAGTATGAAATCGCTTATGTACGATATTATTAATTGCGGACTCAAAT[
C/G]TTGTGATCAAGTCATGTCATGTGTGTCAGTTTCCTTCCATCGAGTCCTGGGGGTATTCGTACTTGAAAAACATAGTTGTGCGCTTAGAGCCATGTT
ATGTCATCACGATCATCTTAGTCAAGCCACAATCTATAGAAATCAGTTAGTCATGTGACTCAGGAAACCTCAAAAATCTCATGATCTCAGTAAATTCTCA
GAGCGTAGTACTATTCCGACAGTCAACAGATGTCAGTTATTTAGTCCATGTACATTCAGTAAAATCATGTTCAGTATCTTCAGATGGGAGTAGAAGTTAG
CACC

chr09 44,504,490 C T C
TGTCTTCACCCTGTCATCTAGG
TCGCAATCGAAATACCCCTGA
22
21
22
59.52
100
AATTTAAACAAATAATGATATCATATAAAGGAAGTTAAAATACAAATAATTATTTTATCTTACTTGATAAATGTCTCTACTTGTTCATCTCCGATATTAA
ATAAAGTATATCGATGTGCTTCAAACCACTGATGATTATTCAGATCAAAAGTCTTGCCTTTCATTTTCTTTTTACTTCCAATTGGATGAACTGTCTTTGG
AAATATAGGTGGAAAACTAGCTCCCTCTATTTGAATGTCCTCATTATCCTCTGTTGGATACCTATTGAATTTTGTCTTCACCCTGTCATCTAGGTATCT[
C/T]GAACAAAAGTTCAAACATTCTTCAGCCAAAAAACTTTCTACTATTGATGCTTCAGGGGTATTTCGATTGCGAACAAATCTCTTGAAGTTACAAAAA
TTTCTTTCAATAGGATACATATGACGCAAATGAGTCGGGCCCCCAAGCTTAATTTCATCTACTAAATGGATAGGCAAATGTGTCATTATATCAAAAAAAC
TTGGAGGAAAAATCTTTACAAGCTCACATTCAATTTCAATGATTTCAGCCTTCATTTTATCAAGATCACTTCTTCTTACAACTTTACTATATATGGCTCT
AAAA

chr09 49,000,005 T T A
TGTAGCCGCTTCAAATGGGT
CCACATTTTCGCAATGAGCCA
20
21
20
60.07
120
GAAGCCCAATCGCTAAACCTGTCCTAATCTAGTTGGGTTTTCAACCCATTTCTCCTTTCACCTGTCCTAATTCTATGTTTTTAAGCCTTTAGCTTGAGTT
TTGCCTCCACCTGTATTAAATACAACTTTAGCTTCGAGGCCCGAATTAATAAATGAGAAAATAAATAAATAAATAAATAAACAAAGACGACGAAATAACA
AATGAATTTTTTGGGTCTTGTAGCCGCTTCAAATGGGTTTAATCCTTCTTTTTTTTCTTCGACTCCTTGCGATCGTACTAATGGGCTTTCAAAGTCTTC[
T/A]AAAATGGCAAGCCTCAATGGCTCATTGCGAAAATGTGGAAGGAAGGAGTCCATTCAGACTCAGAGAATAAATTCACATGCAAAAGAGAAAAAAAAG
GAAACTAACACATATCTGGAATGCAAAGACAGAAGTAAAGAACTTATCCTATGTTCGAAAGTTGACACATAATGAATGACTAACTAAAAATGACATGGGA
CGGCATTATGGCATATAATAAAATTCACATTAGTCTAATCTCTCTGTTTTCATTTGGGAACAACTAATATGTTGCTATGAGAATCTTTTGGCTACCTCGG
ATGC

chr09 70,503,364 T T C
TGATCACAATTGGCTCTCCAGT
ATTGCCCAAACTCGAGTCCC
22
20
22
60.32
144
TATAAAATTTGGATGAGAAAATACAAGAAGCAATAATAAGATGTAAAACAAGGAAAAGATGTCTTACCCAACATGAAAAATATGGACCTAGATAGAGCTT
CTGTAGTTGTCTTGAATATCTTATTGAATATGCTTGGCAAAATTCCCAACAGATTCTGGATAGTTGCTTATATCTATAAGAGCAAGTGTCGTTATATCTA
CAAAATCTTGAGGGATTGAGTCCAAATTCTAGCAACTATCAAGAAATAGGTGTTCAAGTCATGGAAAGTGATCACAATTGGCTCTCCAGTATCGAATGT[
T/C]TGAATATTTTAGTAGCAAGAACTTCAAGAGAGGAAACCCTTCCTCAGCTAATTCTCACTCCTCATTTGTGAAAGCTAAATTAGATATTTCAAGGGA
CTCGAGTTTGGGCAATTTACCAACAATGCTCAACTTTTCCTGATAGAGTACGAGCCCTACTGATTACTTATTTTAGCCTAACGGTTACCTATTGATGGAA
AAAGTTGGCTAATGTGTTCTTATGTAGCTAAAACAGTAAGAAATTACACAGTGATGTTTACGTGGAAAATACCTGACTCAAAGAGGTGTAAAAAACCATG
ACCT

chr09 84,500,004 G G T
TCCCGCTTCTTATGTCCAGC
AGGTTGTTGCATCCTATGGT
20
20
20
56.8
141
TAATACTATAGAGAGTTGGCTCATTTATTGTTCCAACTGTTTGACCGATGTGGAGTGCAAGTTTACTAACTGACTCATGGAGGACAAATTAGTCTTCATG
GTAATCACCCCAGAGTTGGTAGCATCAACTCTCTTTAATATTTTCTCTATTATATCCTCCATAGACATCTTGCTAGAGCTAGTTGCAGCATTATCTCTGC
TTTCTGGAGATATATACAGCCTATTTCTATCATTCTTGCTCTTCCAGTTTCCTTGATCCCGCTTCTTATGTCCAGCCTTGTCATAATAAGTTCGACCTT[
G/T]ATTTCCTTGGCTATTTCCTCAAAAAACCCCTGGTTATTCAAATAATTTGCCTTTTTTTCTAAATCAGAATTATCTCTACCATAGGATGCAACAACC
TTCATTTTTTCGATCTTTGCAGATAATAAGTTCTTAGTCAACAAATCCATTGGCGTCTTCAAATGTTCCATATCTTGATCATATTCTTCCTCTTTCTTAC
ATTTTTTTGTAGTCATACCAATAGAAATAGTAGGGTTTGCTACCATAGAATCCCTGCTATGCCATGCTCTACTTCATTTGGTCATTTGATCAAGCATCTC
CGAG

chr09 95,000,041 C C G
GACCACCCAAAAGCTCTACCA
TGAAAGACCATCGTAGAGTAAGT
21
23
21
56.77
96
CAGCAAATCATGGTTTTGGTCAATGAGTAATCTAATTTGTTCCTTCAACGGGTAACCATCTAACTCTCTGAAGTCCAGTTTTAGATTTTTTAAAACATAT
CTTTTTTTTCTTAAAAATTATTTCTCTTTTATTATTTTTGGGCATGGAAAAATAGGGTATCGTCATACCCAGACTTGCAAGTCATGTCACAATATCTCTA
CTACCATTATCTTATTTCAAAAGTTGTTTATTGACCACCCAAAAGCTCTACCATTTGAACACAAGTTCATATTTCAAAATAGATAGAAACCAAACCATT[
C/G]TGAATACTTACTCTACGATGGTCTTTCATTTAAATCACTTTAAAGCCAGTCTAAATAGGAATCATGATCATTACAAAATGAGCAAAACTTTATTTT
CTTATCTCATGAAAAATAGTACAATTTATACATAATGGGCTAAAAATATTTAACAACTTGCATAACCTATTCTCAACATGAAAAATTGATAAAATAACAT
AGCAAAGGAGGGAATTACATATCTGATGCTCTCATTTAAATTTAGAATCTAAACATCACATGGTCACACAAAAATAATACAAATTTTTTGGCTTCATACC
ATAA

chr09 108,504,573 C C T
TGCACTTTCCTTTTCACCAA
TTGCCTTACTCATCAGAATATCA
20
23
20
55.2
143
TATTGACAACCCACATCCAAGTCATGACACTGAAGCATGCATTGAGGGAGCAAAATAGAGTGGCAGATAGCTTGGCCAAACAAGGGATAAGTGATGCTCA
AAATGCAGCCCTACAAGTTTTTAAAGTTCCACCCCTATATGCTTTAGAAACTTTTAAAGCAGATAGACTAGGAACTTATTTTGATAGACAATTCTGAATC
TGTACTACTAATGGGCATGGGCAAAACTCTAACCTCATGCACCATCCCTTGAACCTTTAATTTAAATGCACTTTCCTTTTCACCAAAAAAAATCTAAAA[
C/T]ATGTTGGATTTAAGTTCCATTAATTTATTGGATAAGATGTCTTTATATGGATAAATATTGAGTTTGATCTTAATACACCATATTGATGATATTCTG
ATGAGTAAGGCAAAAATAATAGGTCTGATGAAAAGTCATGAAACATGTCCTAATAAATAAGCTACATTCCCTAAAATAAATATGGTAGCACTATATGATA
AATCTAAAAGATGACAAATAATTATTGATATCATAAATAAAGATATGTGCGAGAAAATTCTCTATATTATATGCATTCCTCGATTTGCTTCTGAAATAAC
AATA

chr09 114,000,219 A A G
TTGTTCAAGCTTTGTTATACATGA
GCTTGACACAGATCTTGAAAGCA
24
23
24
59.75
126
TTCAAGAATCAAGTTTCTCATAGTGTGGTATTCAAGAATCATTTATTACAAGTGCGGATAGAGTCTCAAGCACTAGAATTCATCCAATTTCTAAGATTAA
GGTATCTGCGGTTTTGAACAAGAGCAATTCTCTAGTTCTTGTGCTCAAAGCTTTGATTTCTATCGCAGGTTTATATGATTTTGCAAGTGGGTTTATACCT
AAATTACTTCATCATGAGATTATGAGAGTATAAATTGTTCAAGCTTTGTTATACATGATTATTTTTCTATTCCCAAGTTATGACTTGATATTTAATATT[
A/G]TGAATTTCATATTTCTACCATGAGTTGATATTTAAAATGCTTTCAAGATCTGTGTCAAGCTTTAAGCTTTCTTATAACAAATTTGATTATTGAGTA
TATTGATTCATGAGATTGAGTTGTTACAATGAGTCTTGATATTTCTTCAAAGTGATTAATGTTGCCATGATTTAATGAATTGATATATTTTGATATTCAG
AAAGATTGAAGTGATTTGAGTCAAGTTAGGAATCCACAAATTGATTATGATTTGATAAATGAGAAAGAGATTTGATTTGGTCTTTATGATAGACCCTTGT
GATG

chr09 134,514,277 C A C
TGGGGAAAGAAGGCTAGGGT
TGCCTTTACTTGAAATTACATGGA
20
24
20
56.85
125
GGGTATGAATCATATGGGTTAGTCGTATCCATGTGATAGGTTTCTAAGAGATTTAAGTAAGGGTATTCTAGACATTTCCCTACTTACCCTAATTAGGAAA
AACAACTTCTAACATACTTAGGAGGTTATTTGCTCTATTATTCTATTTATTAACACTTAGAAACTATTCCAAAAAAAAAACTCCATATTTCTCCCAAGAG
CTTTTGGGGAAAGAAGGCTAGGGTTTTATCTTAAGGATTGTATTAGGGCTTGTCTTGGTGATTTCTTTCCATAAATTCTTTTGTGTAAGGCATAATTCT[
C/A]TTTTTTCCATGTAATTTCAAGTAAAGGCATGATTTATATGATTGATTTCATAGTTTTACTATTTCATGATTATGGTTTTCAACTATTATTTGGGGG
TTTCAATATTAAATACTTGGTTACCGTTTACTGTGATTTTTAATTATGATTTTATATGCATTAATGGTGTTTTTTGTTAATTGGATAAATGGGAATGGTT
TAATGGTCTTTGGAATTGGTTTTGGATGGATTATGGCCCCAATGGATTTGATAAAATACTTATAAAGATATGTTTATTGCATTGACTTCTTTTAATGGAA
CTCT

chr09 158,000,005 G G A
TGTGATTGCATGATGCTTAGTGG
AGCCAACAAGTACAAGAGTCA
23
21
23
57.16
110
GAGCATGACAAAGACTAAGTGTGGATCCCCAGACCCCTTTGATGTGTAAAGATACTACTATCTAGTCCTAGAGTCCTCGTGGAGTATTTATATCTCTACT
TTAAAGTATACTTTAGGGACATAGTAGATTTTTAAGTATGGGGTGGGAAAATTCACATTTTTTAGGTAAATTTAAAATTTTTGGTCTTAGGAATAACTGG
AATATTCCTGTTAGTGCTATATGTGATTGCATGATGCTTAGTGGATTTGTATTAAAAGAGCATGTTGATTATGTGAATTGATACTTTTGAGATTCCTAG[
G/A]CTCATGATTATGACTCTTGTACTTGTTGGCTTAATGTGAATTCATGTGATTGTTTGGTTAATAGTCTATGATGATCCTACTTGAGTTGAGCATGTG
CCATGTGCGTATGAGGTATTTGCATATTGATTATCACGTATGATGTCTAGAACTTACCTAGTGTATGTGTAAAGCAAAATAAAGAGTGTGGGTTTAGGAG
ATAATATAGACATTTATTTGATAGCCAAGTTTATACCCTCTTTTACCTACCCCTGTGCATAATTTTAGTCAGCCCCATTGAGCCTTTAGCTTTTTCTTTG
GCTT

chr09 176,017,086 G G A
ACCTGGGTTAGACCATGTGC
AATTGGAGCCCCTATTCCGC
20
20
20
60.18
130
TTCTACTCAATAATAGGTAATCTCCTTAATGTGACACTCCCTAGTTGTAACACTCTTTTAATATTTCTAAAATGAACTCTAGGATCGTTGTACGGATGGT
AGATCCTGTGTTAATATTGTAGGAGGTGTTAGGGGTATTCTAGGACTTTAAAACTATGTAGGAATCACAAATTAAGGCTTAGGAGATGGCTAGACATCGC
ATTGCCATCACTTACCTTTACTGGAAAAGTTAGGCCATGGGTTAGGCGCCGCCCAACCTGGGTTAGACCATGTGCTAGGCTCCGCCCAACATGTGTTAG[
G/A]AAATGGGTCAGACGCCGCCCAACCTGGGTTAGGCCATTGACTGGGCGCCGCGTACCCTATATTTTGCGGAATAGGGGCTCCAATTTACAGTTAATT
CAAGGAAAAAAAGTTATTTTGCATACAATAATCATTCGTAAACATACTTACATGAAATAAAAGTACCTAAATATATTTTAACTCTCTCAAATCCCTAGTT
TATCTTTCTAAAACATAAGAGAATAAAAACAACTTACAGTTTGGACAATCAAGCTTAAAGAGTCAAACTTCTTCGTTATTTCTTCATAATTAGGATATGT
GGGA

chr09 192,508,680 G G T
AGATGAAACATGGCGATGTG
ACACACAAGAACCATTTAACTCA
20
23
20
56.58
118
CTATAAGACACCTTACGAGTTGGGTCACCTGACCCGTACCCACATCATACAACTGGTATGATGAGTCATTATAAGAACAGTGAGCTCAAAGCTCACGAAA
TTTCCAAGGACCAAAATCTAGGGTGTTTCACTCAATTACCCAATAAACCAACCTACTAAACTAATCCAAAGGACACAAAAAAGCTCCAAAGACAAGTTGA
GGAACTCTTGTACAAGGGATACATCAAAGATAGCATCAGTTCATATATGGTTCTGTTGTTTCTAGATCCAAAGAAAGATGAAACATGGCGATGTGCATT[
G/T]ATTACCAATCTATTAATAAAATAACGATAAAGTATTACCACTTAATTCTTTGTTTGGATGATATGCTTGATGAGTTAAATGGTTCTTGTGTGTTTT
CTAAGATAGATATTAGGATTGGGTACCACCAAATCTAGATATAATTGGGTATTGAGTGGAAGACTATATTCAAGACCTAGTTTGGTCTATATGAATGGTT
GGTCATGCTTTTTGGCCTCATCAACGCTCCTAGTACCTTTATATGGTTGATGAACCATGTGATAAAGTCGTTCATAGAGAAGTTTGTTGTGGTATACTTT
GATG

chr09 204,500,009 C A C
TGTAAAGAAAAACAGTGTACGCA
TCAATCGTATGAAGGTTTGCC
23
21
23
56.6
90
AGAAAGAAGACAAAGAAAGTAGTTCAAGTTATTAAAGGAGAAAAAGAAATATGGAAGATTTATAATAGCTAGATAGCTTTACGTAAATTATCATGTAACT
AGCCTTAGGCTTTTTGACTTTTCTTAGTCTTTTTTGGTAAGTAGTGCTATTATTAGATTTTTTGGCAAGTAGTGCCATTATTAGATTACACATTAGATTT
AGGACTTTGCAGAAACATTTTTTACTTTTGTAAAGTAGCTGACAGATGTAAAGAAAAACAGTGTACGCATTTTCATTTCTAAGAATATAAATAAATGAG[
C/A]ACTTGCTCAGATAAAGGCAAACCTTCATACGATTGAAGCAAAAAACTCTCTTTTGTCTACAACAAATAATTTGATTATTTAAAAAACAGGTATATT
TCAATAAAAAAATCTATGGAGGAACAAAGCTTAGAATTATCAAAACTAACAAAACAGGTATATTCATTTACTATTATGAATAGCTAAATTCATAAATTCC
TAACAATCATGATATGATAAAATAAGTTCATGTTAGTTTATTTATAGTAGAATTATTCGAAAAATAGCATGTTAAGAAGTTTATTAACAAAGTGGAAAAG
GACA

chr09 219,500,067 A A G
ACAATGGGTGTACTGAGGCT
TGGCAAGAAAGGGAAACTCA
20
20
20
57.25
119
GAAGAGATGAGGGTACTTGGTCTGTATATCTACCTCTGCTTCCCAAGTGGCTCCCTCAACGGACTGATTCCGCCAAAGAACTTTGACTAGTGGAACTTCT
TTGTTCCCTAGTCTACGAACTTGATGACCAAGAATTTCGACTGGGACTTCCTCAAAGGAAAAACTGTTCTGAATATCTACACTTTCTAAGGAACAACTAT
AACTGGATCACCACTACATTTTTTCAACATTGAGACATGGAACAATGGGTGTACTGAGGCTAAATCTGAAGGTAACTCAAGCTCGTAAGCTACCTTTCT[
A/G]AAAAGAATGAGAATTCTGAAGGGATCGACATATCAGGGATTGAGTTTCCCTTTCTTGCCAAATCTCTTCATTCCCTTCATCGGAGAGATTTTCAAG
TACACAAAATCACTAACCTCAAACTCGAGATTCTTTCTTCTCACATCAGCATATGATTTCTATCAGCTCTGGGCAGCCCTAAGCCTTTCTCTAATCAACT
GAACCTTCTCTAACGTATCAAACACCAAGTCATGCCCTACTATTGTAGCCTCTCCTACTTTAAACCAACCAATTGGAGATCTACATCTCTTAACATAGAG
CACC

chr09 231,009,169 C C T
TCGATCTACGATTATTTCCTTGA
CCGCCCTTGCCTGAAATTTT
23
20
23
59.68
145
TACTGAAAAATTCAACTGTAGCTATATAAAATATTTCTAAAAACTTAACAAGATCATTAATTACAACCCAATCAAAATCATGTAGCATGCAATTAGCAGA
ATCAACAAATGAACCGCAATGTTGGTTAAAAGCTAGTGTAATAGGAACTCTATATTCATAACAAGTTTTTAAAAAATCATATGTAGAATTTCATCTAATA
TCAATTTCCTCAGGCATCAATATCGGTGCAAGTCCATTTACTTGACATTTAACTTTAAATTTTCTAATTCTCGATCTACGATTATTTCCTTGAATAAAA[
C/T]CAACAGCAAGACGAATTTTTTCAATATAAAACTCAATAAACTCAAGACCATCTTTTACAATTAAATTATATATATGACATGCACACTTAATATGAA
AAATTTCAGGCAAGGGCGGAGATAGCGTAGATTTTATTTTTGTTATAGCAGTCTTGTTGTTAGAAGCATTATCAAAAGCAATACATAAGATTTTATTTTC
GATACCATAAAATTCGGCAACTTTAACAATAGAATCAATAATAAAATCTCCAATATGTTTACGATCTTCATCATATAAAAACGCAAGAATACGTTTTTGC
ATCA

chr10 12,000,078 A A C
AGATCCAACAGCGATTGGACT
TCTTCTCGAACAACCCTTCCA
21
21
21
58.96
144
ATGATAGGTCAACGGGACAACACACATAAAGTCTAATGATTTTGTGAATACATTTTTTAACCGATTAGGCATTGATCATTCAAACAAGATCCTACATTGT
ACAGTTTAGTTTGATAGGTTCGAATTGATGAGTCTGAGGGGCCCATAAAGATGGTGCCGATATCCTGTTATGAATTAGTGACGGTTGTTGCTCATGTTTA
TACGTGTCAAGTTTTGAAAATAGATCAATATTTTGTGTCATTGCAAAGATCCAACAGCGATTGGACTAAAATTTAAGTGTGAATTGGACTTCGAGAAGG[
A/C]CTTCGAAGCGTCACACTACATCAAATAAGAACAGAATACCAATAGAAATTCCCCTCGCTCAAATTTATATGGAAGGGTTGTTCGAGAAGATGATTA
TACGCCAGAAGGAGCCGTAGGAGAATACCTGCGAGGGAAATGAGAGTTGACGAAAGACTATATCATCTAAGAGCTAATTGATGAGGAAACATAGGGTAGC
AAGGAATTTCTAGCAAATTTGGCCAATGAAGCTGAATTAGAATACGAGAAATCTGAATCAAGAGCAAATATGAAAGTGTATCTAAAAATGAAAATCCATC
TGTT

chr10 16,500,051 C C T
GGCTCCTTGGCATTAGGCTT
TGTGTAATGTGGAGCCCTTCC
20
21
20
60
92
GGACTAATATAACAAAAACAATCAGAATTATATGGAAAAGAAAGGAAACTGACATTCTTCATTGATAGGAAGGGAAAGTGTCCCAATCTAATATGCCAAA
GTCTTATATTGCAATCTGCATTAATATAAATGGGAAAAGAAATAGCACTATCATCTTTAAGAATAGTAACTGAAACTAAAGAAATACTAGGATTGGAAAC
AAGTTTCCTACAAGTAGTCTTGCTGAAACTAGAGAGTGGCTCCTTGGCATTAGGCTTGAGTATATAAGGACCTTCTTGTGCTTCACCAAAAACTTGAGG[
C/T]CTTCTAATGGAAGGGCTCCACATTACACAATTCGTTAGAGTTAAATACAAAGTGCAAAAAATCTATTTACATAACTTGTGAATAGACATAAGATTA
TACTTGAAACTAGACACATATATTTAACGCCACGAAATCTGATCCCGGGGCATCACACGATGCTTAAGGCTACGAGTAGCCTCAAGCTAACCCTTTAAGC
CTGCTGCTAAGTCTAAACCTTACTTCAAGATCATCTAATCAAGAAATAATACTGTATTATACCAAAAAATAAACTGAATAAACTGTAGATAATGTATCAA
CAAC

chr10 34,500,027 A G A
TAGCCACCGTCAATGTAGGC
TCCATAATTTGAACCGGTACAGAC
20
24
20
58.82
146
CTACTGATCAACCAACTATTTTCTTTTATTCCTCCTTATTTCTCCCTTTTTCTTTTTATTTGCTTATTCTAGTTGGGTGCAGTTTCTTTTATTCTTTCCT
TTTCTTTTACTGATTTTCTCTTTTTTTTTTCATAATTTCTTTCTTTCTTTTCTTTTTTCCTACCACTCTAAACCTTACTTTCTTTTGTCTTATTTATGCC
CTTCTTCATACCCACTTCAAGTCATGCACCTCTATGATAGCCACCGTCAATGTAGGCGATTTACTTGAGTAGAGATGCACAATGTCCAAGGAGAACCAG[
A/G]GCCAAAATAGGTTCATTGTAACTAAACTTTGAAGGTGAAATGTGAAAATAAGAAAAATAGTCTGTACCGGTTCAAATTATGGATTAAGGGATACTT
ATTCATATTTAGATGTTCATTTCAGCTAAAAGTGGACTAAATTTAAGAACGACCTATGATTCATTACTAACTGACTATTCTACAACCAAGGCAAGACTAA
ATGGGTAAGTTCTGGATTCAACACACAATAGGAACTAAGTAAGCATCTCACACACACATGGCATAGGGTTTTATCAAAAATTACTACCTATTCGGTTCAT
GAAA

chr10 68,501,384 A T A
GGAGTAGAAATTTACTTCTTGCCC
TGGGTCTCTTCTTTAGTACGA
24
21
24
55.48
96
AATTGTCTTTTCACTATTTCCTTAAAATTATTATTTAGTTTTATTTATAATATTGTTCCTAAAATATATGGGATTAATAGTTTAAAATATATAATTTATA
ATATTGTCTCCTAAAATATATGAGATCAAGAGTTTAAAATATATGTTTTTCTTAAATTAAAAGTCTAAATATATATGATAAGAGATTTTTTTAATCAATT
AAAATTTTACCTTATATAAAAATTATATCTTATTATAACTAAACTCACTATAAATATTGGTATTAATTTTAGGAGTAGAAATTTACTTCTTGCCCATCA[
A/T]TCGAGTAATAATTTTAGGGTAGAAATCTTTACTAATATTTTAATATTCGTACTAAAGAAGAGACCCAATTAACATAGATTTTAAAGGAAGAAACAA
TAATAGAATGAGTAGGAAGCTTGTTAGTATTAGCATATATATTAACAAGGTTTAAAACTTTATTAATATCTCTTTTTTTTTTGTTTTCCATACAATTGAT
TATTCCTCATCAGATGAGTTCTGTAAGCTATATTCATATTGTTACGTTTTGCTTGTGATTTTAGGCAACTTTTCTAAAATTTTAATATATTATTGAAATT
TACA

chr10 78,001,237 T C T
AGTGGGTGAAAACACAAGTG
TCGACCAATGTATAATATGCGACA
20
24
20
58.23
138
CCTAAACATCAATTAATAGAGATAGTAAGGTAAAATAATCATATAATAATTATTTTTTTAATGAGTGCATCATGTCAAAAAGTGATAAGTTAAAGCCAAA
TGAAAAAAATGCTATTTTGTCATGATGTTTTCTTATGCTGAGAAAAACTGATAACAAGTACTCACACAAGTTTCTCTTTCTAAAAAAAATAAAAAAATTA
AGGGATAAAAATGTCTTTTAGTGGGTGAAAACACAAGTGTAAACAATATAAATCCCCTAGACAATGACAATAATTACACAAAATCCCTTGTTGTTTTCA[
T/C]TCTCCTTTTCTTTGCAAACATACTCATACATTTTGTCGCATATTATACATTGGTCGAATGTATGATGTAACAGCTAATCCTATATTTAAGGTAAGA
GAATCTTTAATTATTTTACAGTTCCTTAATTAAAGGCAGTAATTAGCCAACATTAAGTCATTTATTGACATAACATATAACTGATATTTGAATTTAAAAA
TTCTGTTATACATAATTTTTTTTCCTGTGATTCACGATCTGAAAAGCCAAAAAACAATCATTTTTTTCTACACCGTTCTTCAAAACTACTAAAATCTTCT
TCTA

chr10 81,500,012 C A C
GGCTTGGGTCTTGGATGACT
ATTCCCGATCGCACGTCAAT
20
20
20
60.18
127
CCACTAATGATATTGGATTGTATAAATGGTGAAATAATGAACATGAATTTTGAAGGCCTTGTTGGCTATGTTTGAATTAATTAACAAAGAGAGTCGAGGC
ATTCCCCCAAGTTAGTATGATTTTTATGGCATAGAGATAAGCTTGTTAGTGTAAGGGTACGATGATACCCATGGTATGCCTTAACGGTTGATTCCTTGGT
TAATAAGTGGGTTATGTGAAACTTATTTTAAATTAGTCTTAATGGGGATTATGTAGCTAAGCCATGAAGGCTTGGGTCTTGGATGACTTATACTGGAAA[
C/A]TCTTGTTTACCGACATGAGGTTTGGTCTTAGTGACCATGTGCACAGTTCACACTATTGATATATTTATTTCTTGTATTGACGTGCGATCGGGAATT
ACCTAGTCTTCCTTAATACCTGTGGTTCGTTCAGCTAACATGCACTGGGGCCTTTTCAACAGGGAGACTGAAACTATATAGCCCTTTGATGCCTGTTTAT
AATAGTTGAGCTACATAGTCCAGGATAAAGTTTTACTTCATGCTAAGCCTCATTCTTTTTCTATACATGACATGTTTATTTCTGTAAATGATTGTGTGCA
TTGG

chr10 113,500,030 C G C
GACTCGACTGACACGACTCA
AGGATGTCCAGTGTTTACCCC
20
21
20
59.37
95
CTTTAGAGACTTGAGAGAGCTTTGGAAGTGTTTGAGTACGTTATAAAGAAGAAATAACCCCCTCAAGTGCTTTATGAACGTGGAGTTTTAACTGCGTGGG
AAGGAAAATATCCAAAATGCCCTCTATTTAAAAACTAAAATTTTGTCGTCAGTGACTATGGGTCACTATACAACTCGAAGAGACTCATAGCCAACACATT
TTCTAGGGCACCTAAACAATATTTACTCTATGACTCGACTGACACGACTCATAATGGGACCTTATGACTTATAGGGTCCAGTCGTAGTCAACACAGAAC[
C/G]CATTTGGGGTAAACACTGGACATCCTACAATTTTCACCCAACAACTCGTAACAAGTCCTTATGACTCTTGTTGAGCCACTCATACTCAGAGTAGAA
CTTAGTCACACACTTATTGTTTAGGTTACGATTTGAGTGAAATGAGTCATCAAGACTCCCTACCGCTCGTAGGGTAAATCATAGTCCAAGCAGTGAGAAT
AAAATTTCAGAAATTTTCAAGGACCAAAAACCCGTGGTGTTACAAATTGGTGCATAATTCGGGGCCCAAATTAGCCCCTAACAACTATGGATTTAAGGAC
TTAA

chr10 127,000,235 C T C
TGCAACTGCTTCTTTGGGGT
TCACCCATGAAATTGGCAGAG
20
21
20
58.55
148
ATGTTGTACAAAAGTATCAATGAAGGATTCATTAGTTTCAAGACACGTGAAAACATGTGTATTTCTCTCTCATCATTGTCAATTAATCTAAATCTGATCA
TCACCTTCTATACTTCTTTGTGTTTTTAATAACATTACTATTAAGATTTCTTTGAATCATCTATAATAACTGAAAATTTGCAACTGCTTCTTTGGGGTTA
TGGAGAGGAAAGAGAGACACAACTATTCTTTGAGAGGTAATTTCATTTATTCATAGTGAGAGACTCAATACAATAATGCAGTGCTGCTTTGGGGATTTT[
C/T]CCTCTCTCTGCCAATTTCATGGGTGATATTTATATTTGTAGCGTCACTGCTTAATTGAGTGTACTCATGCATGCTTTGTTTTGAATTTTTGTTGTC
AAATTTCTTGGTTTCATTTGGATGACGTTTCTTGAGAGGTTTGAGGAATCCGAGAAGATTGCAGTGTGTATTGTTCTAGGGGTTTTTTCGCTCTTCCCTT
TCGACTATTATCACGGTTGTTCTTTGCTTTTTCTTTTTCACTGATTTTGTATATGCATGCACTCATTCACTATTTCGTGTCAATTACATAGACGTTAGAG
GTGC

chr10 135,000,077 A G A
TGCCATGACTGAGTTAGAGTTTGA
TGACTCGGGCTTTCTTCGAG
24
20
24
59.76
103
ACCTATATACTTGTTTTAAAGAGAGAATTATATGTGATTGAGTAAGTTGACATGACCACCTTATGTTACTGAAATGTTGAAAAAGAGAAAGTTTCTTGCA
TGTGTTTACATGAATTTAAAATTTAAAAAATTCTTTGAATTGACTTACTGTTATGGTGGTCCAAAACTACATGTTTTGAAAGAAGAGATGATAATATGCT
ATAAGTGGCTCAGAGAATGTGACTTACAAGTCAATGGTATGACGATACCCTATAAATATATGCCATGACTGAGTTAGAGTTTGATTTAAAAGAATCTAT[
A/G]TTTTAAAAAGTTAAAAACTAGGTTACTGTGAGTTAGGTGGTTACTCGAAGAAAGCCCGAGTCAAATAACTCTATGCTGGAAATCGTGATTTTCACA
CAGGAACTTGGTACCTTGCTATGTGATCTTATGTACCTAGTACTTTGTCATCAGTAATCGGTACTTATGGTTTGGAGCCAGCTTTGTGATCTTGAGCCCA
ACCATGACATAATGACTTGATTGGGGTTGTGGCACCCTGCTGTGTGATCTTGTGTGCTCTTCCTTCACTAATACTCCTATCTTGGTGGCAACCGAGATAG
GGTA

chr10 137,000,106 C T C
AGTGCAAAGGTGAAAAAGTCT
TCAACACCAGAGTCTTCCACT
21
21
21
58.6
127
GCATCATATCTAATAAGTAAAGAGGCAAAAAAGTTTGGCGTTGAGGATATTTTAGAATCATATCCATTATAGCACAGAGGCGAAGGAGTCTGGCATTGAA
AATATTCAAGAATTCTTATCCAATATAGCATAGAGGAAAAAGATTCTAGCATCAAGGATATTTGAGGATTCATCTCTAATACATCATAGAGTCAAAGGAG
TCTACTGTTGAGGATATTCAATCATTTATATCTAATATAGTGCAAAGGTGAAAAAGTCTATGATTATTTATGTCTAATATAGTGCAAAGGTGAAAAAGT[
C/T]TACGATCAAGTATCTTTGAGCATGTATATCCAATATAGCATAGAAGTGGAAGACTCTGGTGTTGAAAAGATATGCACTAAAGCATCAAGAGACAAC
TGAGAGGATTATCGCATTTACTAATTACTGATAGTTGGGAGGGATATTATATCAAATTGAAGAGATCAAGATAGACGGTTGCAGAGACCATTTTATTTGG
AGTAGCAGTGATTGTTGTCATGACCAAATCTATCAGGTAAGGATGACACCTCCTATTACCCACCAGTAGGCAATCCAAATCATACTTTGAAATTAATAGT
AGTG

chr10 146,001,139 A T A
CTCGGTGCCTTTCTTGGTGA
GCAACACCCCAAAAAGGCAA
20
20
20
60.11
110
GTTGATAGGGTTGATCATGATATTGGACATGACTCTTTGAGCTTATGTGATACAAACACGTGCTACTAGTTTTTCTCATGGTGATCATGTGTTTGGAAAT
ATTGTGAATGATAGAATGAACCTTGTTGAGAGAACCCTTTTAAGCTGCAGGTCATTATCCTTGAATTTTATTCTTATCTTAATGGAAAATGATATGTGTG
ATTGTGGGAATGGCATTCTAGGGAAAGAAAAGGTTAGCCTTAGCCTAGATCCTTGGCTACTTCTTCCATTTAATCTCGGTGCCTTTCTTGGTGACTTGA[
A/T]TTTTATTTGTAACCCCTTTCCCAAAGGTGGTTTCATATTTTTGTACCCTAGGGCAAATGTGTCATTGCCTTTTTGGGGTGTTGCTTATACACGTGC
ATTCTTGTTTGACACACTTGTGCTTAAGTTGCTTGAATCTCAACTTTTTGATGCCAAGTTTATGTTTCATTTGAAAGAAGGAAGTCATATGTGTTTAAAT
GATTTGATTCCATCCTTATGTGCTAAAACTATTGAATCATTTGGCATTTTTATCCATGATAGCATCGTGGATGATGCCTTTACACTTGATGCCTTCCTAT
ACTA

chr10 174,500,207 T C T
TCCCACCCCTATTTAAGCCC
AGTGAAGATTGACGGAGATACT
20
22
20
56.38
144
TCTGCAATAATGGCGTTTTATGCCAAAATTCTAGGTCACAAATAAAGTGGCAACGTGATGGCTCTGTGTCGCGCCATCCCCCAATTTCTCAATTATCAAA
TTCCAGTGACACGGTGCGATAGCGCCACATCGCGCCAGGGGTCCAGTTCGGTAAATTTTCACCAATTTGAAAGACACATCCAGGGTTAAAATGGTTGGTT
TCCCACCCCTATTTAAGCCCTTTAACATGAGATTCAGCTATTTGGAACTCAAAATATACTAGTTTCTCTTAATTTTCTCTCAAGAACAAGCTAGGGTTT[
T/C]AATGGGGATTCAATTTCAAGAAAGTATCTCCGTCAATCTTCACTAAATCAAGTACTAATGTATGAGTCGTGTTGATTTATGGATTCCTTTCATCCA
TAAATCTCAAGAACCCTATTTTAAATTATGAATCATGATATTTATGTTGTGGGTTGGTTGTAACCATGTTTATCTTGTTATATGGTTCCCACATTAGAGT
ATTTGTGTGTCTTTCATAAAACTACATTAGCAAGTGAATGAAATCCGTAAATTAAGTTATTTATAATATGGTAATTTGATGATTATGCCTATGCCCTAAG
AGTG

chr10 199,009,449 A A T
AGCTAACAACACTAGGGAAACT
ACCATTCTCATGTTACTGCTTGT
22
23
22
58.34
133
TCTGAAAATTCGAAAACTCACCCGACATGTACTTTTGACCACCCTAAACAAGAATCAATATAAAAACCAATATATAGAGGTCGGGAAGGTCAATTTAAAA
ATCCATAAAGTCTAGGGGTCTTGAAATTAACTAAGTCCTCAACACTAAGTGAAATGTTCAAGTCTTGGACCCCTTAAATATGCAACTGAGACCTGAATTG
ATCTAAGACACTTATGGGGTATTACAATATCTTTCCATTGGGAATATTCATCCTTGAATGAGACTATTAGCTAACAACACTAGGGAAACTTAGATCATA[
A/T]AATAAACATGCATGATTGAAAACATGATTACATAACGAGTCTTAAACATGACACATGAACTGAACTGATCTCATGAATACAAGCAGTAACATGAGA
ATGGTTATAAGGCTTTGATAGAAATGAGAGAGTCAACTTATGAGTAACCATTACCTAAAGTTGGATCTAGTTTCATGAAGAAAATATGGGAGGTTTAGGA
CATGGAAACTCGGGGTATTACAGTATCTACCCAATGGGATATTTTATCCCTTGAATGATACTGACTTGGCTGAAATACTAAGAAAAGGCTGAGATAATAC
ACGG

chr10 216,503,402 C G C
CCAAAATTTTCAGATTTGGGCTCC
CCCACCTCTAACACCTGCAA
24
20
24
59.6
144
AATTTTGCACAATGTTTTATATATATACAATTATTCAACAATATATAATTAAACAAATATGTACATATGCATGTGTTTAGATAATGTATCTACATTATAT
AAGTGTGTATAAAATGAAGTGGAAGAAGAAAATCAGTGTATTGCCTATACAATAAATATAATACAGTATACAAATGTATACACAAAATGGATTTTGTCTT
CTTCCTCGAATTCAACCACCAATTCATTCAAAAAATACCTCAAAACTACACTAAATCATCCAAAATTTTCAGATTTGGGCTCCTAAATACATAACCGAT[
C/G]TTTTATAACTATACCCACTCGAAATAGAGACTAATGACAGATATCTCGTTGATGATCATTTATCTCAAAAATCGATAACAGTTTTGCAGGTGTTAG
AGGTGGGAATTATAGTTCATTCAATAGTAATATGCTATCTCTAGGTACTTCAAACAATACATGCACAATAAAGAACTTGTTCCTGCAATTTGCTTTCATC
AGATGTTTGAATGGATATGGGCCTTGATAGTTGCATTCTCCAGGCAAGTTTTCATTTTGTGAAGAAATTTCTTTTGAAATACCTTATTAGAAAAAATATC
AGTC

chr10 223,513,972 A A T
TGTGGGGCGATATGGGTTTT
CATAAACCCGCAACCTGCAC
20
20
20
60.11
109
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCGTCGCTGCTTCATGCTCCAATAGCACCGGCAGCCGCATGAAACTAGTCGGAGACGACCAAA
TCATCCAAATCGTCCGACCATTCAATCCATTTTATCGAAAAATGATGGATTCATTGGAATTTATCCCAGGTAGAGATGACAATGGGGCGGTGCGGGTGCG
GTATGATGCGGGTTTTAAACTATGTGGGGCGATATGGGTTTTAAGTTATGCGGTGTGGTGCGGTGCGGGTGCGGGGAGGGTTAAAGTATGTTTTTTTTT[
A/T]AAATTGGTGCAGTGCAGGTTGCGGGTTTATGCGAGTTTAAATTAAAATAAACTAAAAATTAGTATTGTTCTCGTGAATATACCTAAAATTATATGT
ATTCTTTAATTAAAAATTGATGAAACTTAAAATGACATGTATAACACTACAAATAAATAATTTTATAGTAACTTTTTTAAAATCTCTATTTATTTTAATA
AAAATATGCTATTTGATCATTACTTGTACACGGTATACTTTTTGACAATTTTTAGTGAAAAGTGATATAATATAAATTAGTTATTATTTCCTAGTTGTAG
ATTT

chr11 22,004,472 C C A
ACATCAAGTCAAGGTTCACCA
AGATGGTTCGGTGACAAGTAGT
21
22
21
59.1
127
AAACATAACCATATCACCATGGAATATATATCTAGTCAATACTTTCCAACCACTCGTTATTAGTTAACCAATACTTATTATAATAGAATCACCAGTTCGC
TAGTATCACAGAACCTCTAGTTATTATCCCAAACCTTATCCTTCACATAATCCTTATTCACGGGATAATAACTAACCACTATTTATTTAATAGTCAACAT
CTAACATCAAGTCAAGGTTCACCATTAGAACGAAACCATCATTTATCCACCATTCATTATTATTGACTACTCATCTTATATCTATTAATCATTACTAGA[
C/A]AACAGTTTACTACTTGTCACCGAACCATCTTTTATTAACTGACATCATTCCTTAAATAACCATCGTTAGCTTCCATGTTTCAACTATGCAAGATTT
GTTAACTAATACTTTAGATTCGTAGCCATCAAGTGCTATAATCCTCTAATAGATACCTAGTTACCACATAGCTTAACTGTCTAACCAGAAGAGCAGTCAT
AAGATAAATTTTTAGCTATAATCACATCATTTATAATGGTAAATAATCATGAATGTACTGAATCTATGCATGCAATCACCGTTATTCTGTCATGCAATGC
TTCA

chr11 27,015,451 G A G
GCTTCCTTCGGGGGATTGAA
GCAACAAGTGAACTGCCAGG
20
20
20
59.97
113
CCCTTCAAAATTATTTTTCTTGTGATGGTTGTTGCTCCAAACAATTTCTTTTTATTCTATCAATGACCTTAAGGTTCGATAAAGTTTGCACAGATCGTAA
ACTAAGAAAAATGACATCTTCAACTCTTAATTGACCGAAACAAGCCACGGATGCACAATCTAAAAGAAATCAATACATATATTAAAATAATGATTAAATC
ATTTAAAAAATTATTAATTAAAATAAAAACTTAATTAGAAATAGACTTACTGCTTCCTTCGGGGGATTGAAGAGGTCAAGAAATTTTACTTTTTAATCA[
G/A]TTTGACCGACAAACATCTCAGGATTCTTGAACATAAAACTTCTTCCTGGCAGTTCACTTGTTGCCTCAAATAAGGAATGATTTTAAATGCCCAAGC
CTATAAAATATCGTCAATAGATCAAAAGCATTATTCAATAAAAAATAAATGAATCATAATAAAATAAATATTTACGATGAAAGTCCATGGAAAGCCATAT
AAGCTGACTCTCTTTCGCATTAACGGAGTCAACAAATATTTGATAGTCATTTTGAAGCTTTCATAACTGCAAGGATAGCTGCTAAATGCCTCAAGATCCT
CGAA

chr11 46,515,907 C T C
GACAACCACCAATTGCCACC
TGGATTGGAGGGCTAGGGTT
20
20
20
60.25
145
AGGCTACAACCTCTCAAGCGTGCCACCAATGTCATTTTATCCTGCCTTGACACTATTTCTTGAGACATGGTTAGGTTAAGTGCAGGTCTTGAAAATTTGG
ATTCGGATGTGGAATCAATGGGTAGGAGGTTATAATGAGTGGAGAGCAAAGGAGTTCCCAACCTTCTAGTCCTCAAAACATTTCACCAACCATTACTCCC
GACACTTTTCACCAAATGTTCAATCCCCTAAGACAACCACCAATTGCCACCAATCAAACCAACCTCTATTCCTAAAGCTATTATCATGATAGGCTAAAC[
C/T]ACCCTCCACTTCACGAAGTCCAACAAGAATGACTTGGGACCCAAATACCACCCCAAAACCCTAGCCCTCCAATCCAAACTCCATATACCCAAAGAC
CCCACTTCTCACCAAATCTACTTCCACCACTATAAGTTTCACTGCCCAAATAGACCCATCCATGTAAAGGCGTATGGTAGAGGAGAACAACATAAGGGAT
ATGGGCCATATGATGATGCTTACATGAGGTGGGGAAGATATAAGAGGGAGACATGGTGATCCAATGGAGGTTCAAGGCTGAGAGGTAAGAATTGGACAAT
GAAA

chr11 65,500,121 T T C
AAGTGTCCCAGTGCGTGTAG
GACCGTGTGCGAGTATCACA
20
20
20
60.11
95
AGGCACCGTGTGGCATCTCGGGATGATATTTTGGGGCGTTACAAAATCTCAGGATAAGGATAAAATAATGTCAGTCATAAAACCAAGTACAACCATCCAA
ATGCATACAACCATACATATATATAAGGGCTTGGAAAAAGGGATAGGTTTTAGCATGCACTTAAAAATTTTTCCTGGGTTATGTTGCTTTGTCGTCCTAA
CCACATATGGCGATATGGGTTCAGCTCTCCCTGCTGAAAGTGTCCCAGTGCGTGTAGTTGCAGGACCAGGAAAAATCCCATGTGATGACTAATACATCC[
T/C]TCCAATATAAAATGTGATACTCGCACACGGTCATCAAGGAGGCCTCATATCGACAAATATGAGTTTTTGATTTTGGTCCCCTCGGGATCACCACCT
TTCACGGCTTAGATACATACCCCATCATTAAGCCCAATTAAAACCATATCCAAACAATTAATTTACCATTTATTGACCAAGGTCAATATTAGTGGTATCG
TCATACCACCCCTAATTGCAAGTAATATCCATAGTCAAACCACTTAGGTTAAGGGGACCTTAGGTTCCATTACCATATGCCATAGTAAATCCACTTGGCA
GACT

chr11 70,000,864 A C A
GCTGATTACCTCTGCATTGTGT
ACAACTTTCTGTGGATCCACT
22
21
22
57.14
150
TACGATGCTAAGTTTTCTCTAAGATTGATCTTCAATTCAGGTATCATCAGTTATATATTAGGGAGGTGGATATACCTAAGACTACTTTCTGTACCCAGTA
TTGGCATTTTGAGTTCTTGGTTATGTCTTTTGGGTTGATTAATAACTTGGCAGAAATCATACACTTGATGAATAAAGTCTTTCATTAGTTTCTGGATTTA
TTTGTTATTGTGTTCATATATAATATTCTAGTGTACTCTAAGAGTGAGGTGGATCATGCTGATTACCTCTGCATTGTGTTGTATACCTTAAAAGATCAG[
A/C]AATTGTATGCCAAATTTTTTGAAATATGAATTCTTGTTGAACATTCTCAGTTTTCTAGGTCTTGTCATTTCTAGTGAATGGATCATAGTGGATCCA
CAGAAAGTTGTTGTGATTAAGAAGTGTCCTAGATCTACAACTCCAACCAATATTCGAACCTTCTTGGATTTGGTCAGTTATTATAGAAGGATTGTGGAAA
GTTTTTCTATAGATGCCCCATTCAATATGTTAACTCAGAAGGAGGTGAAATTTTTATGGTCTGATGCTTGTGAGGGTAGTTTTAAGAAGCTAAATCGTAA
GTTA

chr11 80,393,913 C C A
TGAATCTGATGATCAAGGATCTCA
TGGCGTCAGTGTATCCAGTG
24
20
24
59.75
148
ACATGAATTGAACTGAATATATGCAATGACATGAGATAGATTACATAGCCAAAACTAAGAATGGAAAAGAGTCAATTTGAGGAAAATCATTACCATAAGA
TGAATCTGAGTTCACGAAGAAATGATGAGTGTACTTGGTTCGCATATCTTCTTTAGCTTCCCAAGTGGCTCCCTCAACAGATTGATTACACCAAAGAACC
TTGACCAAGGGAACTTCTTTGTTCCTTAGTCTATGAATCTGATGATCAAGGATCTCAAATAGGATTTCTTCTTAAGAAAGGTTATCCTAAACATCCATG[
C/A]TTTCTAATGGGACAACAATAGCTAAATCACCAATGCACTTCTTTAACAGGGAAACATGGAACACTGGATACACTGACGCCAAATCTACAGACAATT
CTATCTCGTAAGCTACCTTTCCAAAATGACTCAAGATCTTATATTGGCCCTTATAACAGGGACTAAGTTTCCCGTTCTTTCCATATCTCTTTACTACCTT
CATAGGTGTGATTTTTAAATAAACCAAATCATAAACCTCAATCTCAAGATCTTTTCTGCTCACATCTGCATAAAATTTTTAACGTCTTTAGAATGTCTTC
ATCC

chr11 107,500,122 A A G
AGAGAACTTTGGTGCGGTCA
TGAAATTCAACAATGACCCAACA
20
23
20
57.4
117
TCTAGAGCATCACAGGTATGTTCCTACTCCCATGTGTTATTTCTTTTATTAGTATGCATTGGGGATAGTATGTCAGATTTTATTTAGGGGTGGGGGTGTA
CCAATGAGGTTTTTATTATCGTGTCTCTTTTCCCTAGAATGTGCTACCATAGGAGAGCCGACATAGTTAGGTTATTGTTATGTTCATTATGTGTTATGTG
TTGTTTTGTTTGACTAGGGGAAAAATAGAGAACTTTGGTGCGGTCAAAATTTTTTGTTTTTGTGTGTTTTATAAAAATAATACCCCTCTTAATTTTTGC[
A/G]AACTATATGCTAAGAAGATATGTTGGGTCATTGTTGAATTTCATTATTGAATCAGTATTAGGGATAAAATAATCATAGATAACAAGTGCATGAACC
GGATAGGTAGTAGCTGATAATGTAATCCTGTGCCATGTGTGTGAGAGATATTTAGTTAGTGCACTTTGTGTGTTTGATCCAGAACTTGCCCAATTAGTCC
TTCCTTGGTTGTAGGATAGTTGTTTGGGATATGTCATAGGCCATGTTTGAATAAATCCATATTTCTCTTAAAAAGATCGACCAAATGAGAATAATTTCCC
TTGC

chr11 110,000,021 G G A
TGTGTATGTGAGGGTGAATGCA
CATGATTTGTGATTTTAGCTCTCA
22
24
22
55.76
130
TGAAAATAATTGAAAAATCTACATTAATAAACTGGAAATCTAAATAAATGGGTCCCCAAACTATGAGGACTCACCAACTATTGGGATGTATATGGAGATG
GTCGAAATCACTCACGCTGTTAAAACTGAGCACCTGAACCTACATTATCAAACAATATGGCACATAAACATATATGTGGATCAGTACTTTTAGAATGTAC
TGTGTATGTGAGGGTGAATGCATAGATGAAACAAGATTTTAATATTCATGAAAATTCATGAAAAGGATGCATGCTAAGTGTAATGACTCATATTGGCTT[
G/A]AATAACTGAGAGCTAAAATCACAAATCATGAAAAATAAAGCATACTATGTAAATCTTGTGAGTCATCACATTTAGTTTTAAAAGGTGTACTTGCAT
TCTATCTTTAAATCATACAGGCTAAGTGTAGAAAGGACTCACTTTTATGTTTGTAAGCTGAAAACTAAAATCTCATGACTAATATCTATTGTAAAGTAAT
ATCTGAATATTATTGTGAGCCTTTACAATTAGTTTTTAAAAGATTTTCTGTTATTCTTTTCTGTTAGGACTTAGGAAATTATTTTAAAAAACTTCTCTGT
AAGG

chr11 132,500,017 A T A
AAAGGCACTCTTAACGACCA
TTTTCCCCTGTGGCAAGGTT
20
20
20
60.03
98
GAACTACCATAAATGATATCATCAACATAAACTTGCACAATAAGTAATTTGAATCAAGATTTTGGATGAACAAAGTTGTATCAATGTTACCCCTTTGAAA
GTTTGTATTTAATAAGAAATTACTTAATCTCTCATATCTTTTGGAGCTTGTTTGAGTCCGTAGAGTGTTTTTGATTATTTAAAAACATGATTTGGATATG
CTGAATTTTCAAACCATGGGGTTTGTTTTACAAAAACATCTTCATGAATAAAGCCATATAAAAAGGCACTCTTAACGACCATTTAATATATCTTAAAAA[
A/T]TTTAAAGGTAGCAAAGGTTATAGAATTGGAATTGACTCTAACCTTGCCACAGGGGAAAAGGCCTCCTAATAATCAATACCTTCTTGTTGAGAATAA
CTTTGTGCCACAAGTTTGAATTTATTTCTAATAACCTTACCTTCTTCATTCAACTTGTTTCTGTAGATCCAGCTCGTTCTAATTACAGAGCAATTTCTAG
GCCTTTCTACTAAGGTCCAAACTTGATTTCATTAAAACTAGTCTAATTCTTCCTTCACGGCTTCGACCCTTATTTCATCTTTGAGAGCCTTATCAGTTTT
CTTT

chr11 164,001,501 G G A
TGATGTTGTAGGGGCAAGCG
AGGGAAAACAACTGGCATTGTC
20
22
20
59.63
87
AATGTTAGTATTTATCAAGAACTTTTCTGTCGGAAACTTTGTTACTCAACAATGACATATGCTAAGATAATTAAGTTTGGTGTGGCTGGTAAGGAGGAAA
ATGTTCATGGAAAATTTTTTTGATGAAAATATTTTCTAGGAAAATAAGTTCTTTCTTACTTAAGTTTTTGTATTCAGTAAGAAACTAAAAATATTATCTT
AAAACCATTTGTATATATATCTAACACAAAACTATGAGGATGATGTTGTAGGGGCAAGCGGTACGTGGGTGGATGGGTGGTTGTGAGGGTGGGTCGGTG[
G/A]GATGAGACAATGCCAGTTGTTTTCCCTACTTTAAGTAAGGAAGTCATGTTCCTCATTTTCAAGGAGCTTATTTTCTTATATAAAATATTTTCAAAA
ATATTTAGCACCGAACGCAAAAAATAAGAAAATATTTTCTGAAAATATATTCTTCTCTATATTATTGAGCACACCCTAAATGTACAACCATTCAATTAGA
TTTAGTTATTTCCAGTCAAGACTCTATATAAAAGGATAGAAGGCCTCTCACTAAATTTGTAAACTTTCTCATGTTAGAAAATTTAAGTCACGACTAAGAA
ATGT

chr11 177,000,079 C C T
AGGATGCATGAACTGGCAAGA
CCTCGTACTCGTCATCAGCA
21
20
21
59.27
88
CTTAAAATCGACAATGCATGCTCTCAATATATCTTCTATAGTCTGAATGGTCTTTTTTACTTGACCATCTATTTGAGGGTGGAAGGCTGTACTTAGGTGA
ACTCGGATACCAAGAACCTTTTGGAATACTTCTAGAAATGAGATATAAAATGGGCATCTCTATCTGAGATGATGGATACTATGACACCGTGTAACTTGAC
CAACACTCTCATATAGAGTTTGGCATATTCCTCCACTAAATAGGATGCATGAACTGGCAAGAAATAAGATGATTTGTTCATCCTATCTATGATAACCCA[
C/T]ATATAATCATGCTGATGACGAGTACGAGGAAAACCCATCACAAAGTCCATGTCCACTTCTTCCCATTTCTATGTGGGAATAATGAACTCTTGCATG
GACCCTCTAAGCTTCTGGTGCTCAATCTTAACCTGCTGACACATACAACACTTAGATATAAACTCCACAATATCCCTTTTCATCCAGCTCTACCAATATA
TTTCTCATATATCATAGTACATGTTAGTGGCCCCTGGATAAATAGAGTATCGCGCACCATGCGCTTCTGCATGAATTCATTACCTCGAGTCATCTACACC
TGGC

chr11 190,500,047 C T C
ACTGACATTGGTACTGGACTGA
ATGGCTTCAGATCATTCAAGT
22
21
22
55.26
130
TAACACTGGCTGTGTGGATCCACTAAGATGGTGTCTTGAAAGACTAAAGAGTTACCCTCTACTGGCAGGTGATCTCATGAGATATGTTTCAAACCTTGAC
TGGCAGATATACATCTTAAACCTATGATGGCTATGCAGTAAGGTAACTCAGGGATATCTACTAAGGGTCACACCCTCTACTAGAAGGTGAGCCCCTATTC
CTGGTTTCACTCAGTGCTAAATCCTACTCCCAAATTAACTGACATTGGTACTGGACTGAACTAAAATTGAACATTATTACTGATAGTATTCATTATAAT[
C/T]ATATCAACTGAATAAATAGGAATATTCATGGTTTACCTGAATCATTACTTGAATGATCTGAAGCCATTAAAACATATAGGTATCGAGTGTTCATAG
CCTGCCAACACTGAATGACCTTAATTTATGACAATAATCTTTTAAAATAATAATATGGAATCATGGTTCAAACCCAAAAGCATAGGCATTTCATGAAACC
TATGAGGATCATAAACATGAATATAGGAATGTGTTAAACATAGGAAATCAACATTATTCATGTGGCTAAATTCATAAATTATGGAATTTATCATGAAATT
CACT

chr11 202,500,101 T T A
AGAAAGCTTCTAACATTCTTGGG
TCCTTCTTCCCCACAACTCTC
23
21
23
59.02
88
ATCACGTTGCCACCTTGTATGCGACCTGGAAGTTTGGCACGACATGCCGCTATCATGGAGCAACACTGGAAATTGACAATTTCCATTTGAGCTATCTCCA
CCACGCACTGAAGGCTCAGGTGATACACTATCTAACTAAAAAGGCTCTAACTCTTTATCAGATTGTCGGATTTGAGCGAATTTAGTATTGATGGAAATCT
TATTCGATTTCCCACATGAAAAAAGTGAAAATCTTAAAAATACCACATGTAAAAAATGGATTCATCTTTCAAAGAAAGCTTCTAACATTCTTGGGAAAC[
T/A]TTTCAAGCTAGGAAAAGTATGGGGTATTACAGAGAATGAGAGAGTTGTGGGGAAGAAGGAGAGAACTAAGAGGAGATGAATAACCCTAGGTACTTT
GAATACAGAAGAATTTGAACAATTTTAGGATTTGAAAGGGTGGAAACATACATAGCCATTTTCTTTTATCACTTTAAAGATGGTTGGGTGAGATAAAAAT
ACATCATTGAGCTTTAAATTCAACAAACCCGACCCACTAAAAATTAGGATTAATTTAACGGACATACCTATGGTCTGTCAGGTACCTGACAGTCCATCAG
GTTC

chr11 227,000,075 A A G
TGAGGCAAAATGTGGATTGAGT
AGCCAAGTGGGAGCTAGAGA
22
20
22
59.96
123
ATTATGACTCATAAATCAGACTATAACAATTAGCGAATTTGATATTGTCAAATTCCTCATACCAGTGGTGCTAATAGTTTGGCAGAAGAAGGGATGAAAT
AGTTTGATGCGATGTGCTAGTTTGATAAGATATGCCTAGATAAGTATATTCTTAATTAATTATTGATGATTTACGATTTGAAAATTTCAGATGGCAAAGG
AAAAAGTTGTTGATTGAGGCAAAATGTGGATTGAGTCTCATAAGAGGAAAAATGGGAGGTTTGAACCTTGAATTTATATCGTAAGTTTTCATAAAAGGA[
A/G]ATTTGGGTGAATCTGATTCTCTAGCTCCCACTTGGCTCCGCCCCTGCCACTGAACTAGAACAATGTATTTTTATTCTATTTAAATTTTGCATTCAA
TTAAATTAAGACAAATAATATGATTCGGGCATTTTCTGAATCTTCTCTATGTGTACTTGCTCATTTCTCCTTATCCCACTTCCCTTAATGTCATAGTGTG
AATTAATTTAGTATTCGATCATGACTTTGGTGCATGTCCAACTAAGATAATTTAAGATGCACATGAGGAACGATATTTCAATGTAAAAAAACTAATCCCA
ACTG

chr11 236,525,986 A A G
TGTCAATCACTTTCAGTTCATCA
GGATCTCCCAGTGTGTGTGT
23
20
23
59.31
150
CCTGAACCTACATTCCGAGAAAATGCAGCCCACATCCGAAGATGTGGGTCAGTACCATGGAAAGGAACCGAGTATATGGGGGTGTATGCAATTTTATAAA
CATCATCATCATAAATTTTTATAAGAAATATGCCGGATGTATGAAAGACTCACATAGCCCGAAGAAAATCATCATAATCATGAGAGGATAAAATAAGTAT
AATAACATATGTGAGTCATCATATAATTTGTCAATCACTTTCAGTTCATCAAGAATATCAATTCTCATAATGTAAATATCATTTAAATCTTTCGAAAGA[
A/G]TAACTTTCACAACTCCACTTTCAAATCACTTCACCGTTCATCATAGACACAAGAAAACACACACACACTGGGAGATCCTATAACCGACATAAACTA
TGTGAGCTACATGGAGTCCAACGTACAACCCACGTTGGGGAAAGGAGTCCTATCCTTGCCATCGGAGTAGGACTATCGATATCAAATCCACACAAACTAG
TGATCACTATATAAATCANCAGCCTCAGGCTCACTCCTATGGGGGCACGTAGTTCTAGGAAAGTAAGGTAGCTTTATACCTCCCACTTGGTGCTAAAAAT
TTCT

chr12 19,001,116 G G T
GCTGGATCACCTATGCGCTT
GGGAAAACTCAGTCCCCGAT
20
20
20
59.38
150
GAGAAGAGGTAAGGATACTTTGTCCATATATCTGCTTCTACTTCCCAAGTATCTCCCTCAATGGACTGATTCTACCAAATAACATTAACTAGAGGGACTT
CTTTGTTCCTCAGTCTGCGAATCTGGTAGTCGAGAATTTCAACTGGAATTTTCTCATACCAGAGTCTGTTCTGAATATCTACGCCTTCAACTGGGACTAC
AACTGCTGGATCACCTATGCGCTTCTTTAGAAAGGGGACATAAAAGACTGGATAAACTGAACCTATATCTAAAGACAAATCGAGCTCATAAGCTACTTT[
G/T]CCTAAACGACTGAGAATTTTGAAGGGACCGACATATCGGGGACTGAGTTTTCCCTTCTTGCCGAATCTCTTCACTCCCTTCATAGGAGAGATTTTC
AAAATAATAAATTTTATTTGATCTTAACTTAAGATCCTTTACTGAACATGCATGAATAGGAACATAAGAGCATGACTAAGTCTGTAATGTATGACATGGA
CTGACTATCATAAACTGAACTGAGCTATTGAGTACATGGCTTACGACTGAGATTGGAGATTGAGGGTCAACCTATGGGTACCCACTACTCCAAATTAGAT
TTTT

chr12 23,021,752 C A C
TCGCCACACATGTATATTCAT
ACGTTCTTGTGCCCAAAAGT
21
20
21
58.53
149
ATATATAAATATACATTGGGAGCCATCATGCTTCCCATCTATCAATATCAACCACGCTGTGGATTTCTTTCACACTCGAATTCAAACAAACTCCATTAAG
ACCAAATGTCAAATCATTTAAAATATCTCAAATATTCAACATCAACGTGCTTATAACACACACTTTCTCAAAAAAAACATAATTTCCAATGGGGATTCAT
GACCCAAATATCAAAATCATGATAAATATCGTTCAAGATTCATGCTTTATATCGCCACACATGTATATTCATTTTTCAAAATCATAAACATCAAGATTT[
C/A]ATAATAATCATCATAAGATATGGGTTCATTCTTCAAATTCGTAAAAATCAAATAAAAATCATGCCTTTGTAAAGAAAATTACTTTTGGGCACAAGA
ACGTAAGAGAGTTCTTGTTGATAAACCCCACATACCTTGAATGATGAACTTTAGATCGATACTCATTTTTGAGATATTACTCATGCCCTTGAATGATGGT
TCTTGGAGTTCTTGAACTAGGAACTTGGAATCTTGAATAAATTTGCAGAATTAATGGTGAACTTTGGAGGTTCTTGAAGTTGGATGTAGGAGCTTAGGGT
TTTC

chr12 26,000,023 C C T
GCAAGCTTAGCCCCTCGTAT
ACGATGAAGCATAGAAACATGA
20
22
20
55.9
131
TTTTTGAGGCATTTTATGATAGGCATTCTCACTCCCCAGCGGGTTGGTTTGATATTTCATAGTTGAGACCTTAAGGTATAGGCTTCTTTCATGATTCTTT
GGATAGAGTTTGGGTCATTCAGTATAGACTTAGAGAGCTTCAGAGTCGGCAGAAGTGCTATGCCGATCGTAGACTTTATTTCTTGAGATTTGATGTTGGT
GATCATGTTGTCCTTCAAGTTAGACTATCAAAGGGTGTGGTGAGGTTTGGAAAGAGGGGCAAGCTTAGCCCCTCGTATATTGGTCCATTTGAGATTCTT[
C/T]GTACTATTATTGATATGACTTATAAATTGGATTTACCCCCTAATCTATAAGTTGTTCATTTAGTTGTTCATGTTTCTATGCTTCATCGTTATATTC
TTGATGAGTCTCATGTCATTCATTGGGAGTTAGTTCAGTTATATGAGCGATATTCCTTTGTTGAGGAGCCAGTTTCTATTTTGGCTAGGGATGTTAGGTA
GTTGTGCTCTAGAGTTCTCCCTGTGGTTAAGATTCAGTGGAGATATTGACCTGTAGATGAGGTTACTTAGGAGGGTTAGTCTGATATGTGTAGTTCTTAT
CCTC

chr12 47,000,006 G G A
AGGCATTAGATGACCCGAGTC
TCTTGGTGGTGGGTAGCTTT
21
20
21
58.85
134
TAAGGCAAATTATTAGACTAACTGGAGGAATGTGATCCTTAGGGAAGGAAAATTGTATTGCCTTGGAGAAGAGGTAGATTAGAAGTGAATAAGAATGATG
AAAAATCTCAAAATGGAGAGAATGTTGAGGGAGAGGTACAAGAAGAAGGAGATTATGAAGATGTTTGGCCTCAATATGGAGAGTTTGAAGTGCCTAACTT
TGTGGTAAGACGATTGATGATTAGTAAGGCATTAGATGACCCGAGTCAATGGGAAAATCTATTCCATACAAAGTTTCTTATCAAGGAGAATATATGCTT[
G/A]TTGATCATTGATAGGCTAGTGCCACCATGGTTTATTTTCTAAAGCTACCCACCACCAAGAATACTAGTACATACAACTCTAATGGTTGAATAAATG
TGGAGAGTTAAAGGTAACTCGACAAGTTGTGATCTATTTCAAAGTTGGGAATTAACAAAGTGAAGTGTTATATAATGTGATTCCCATGAAGGCTTGTCAC
ATCTTATTAGGAAAACCATGGCAATATGATCGATCGACTAAGCATGATAGAAAAACTAATCAGTATTCCCTTGAGATGAATGGACAAAATTTTACACTAT
ATCC

chr12 77,500,546 A A T
AGGAAGCTAAGGAGTAGTGAGAGA
ACTTTTCCGCCTCATCTGGG
24
20
24
60.04
130
GCTACAAAGTTTACTCCTTCAACATTAGTAATCCTCATTACCCAAAAGATCTCCACCATATCATCAAAGAAACCCTATATCATTCCTCTACCATGACTCC
CACAAAATTTGGAGGACCCATTTTTAAAAACTGTCCAAGCCTAGTGGCCTCAATAAATACAACACTAATTATACCCTGCTCGGCGAGCAGTAACTAGTTG
GGAAATAGCATACATAGACAAACAAAACTCCACATTTGTCACATTAACCTAAGGAAGCTAAGGAGTAGTGAGAGAAATAGGAGGAACTTTAGTATAATT[
A/T]GGAATAATACAATAAGATCAAATATGTACTCTAAACATAAGAGGTACCCCTTCAGTATTTCCCCAGATGAGGCGGAAAAGTTTTCTTGCATTCAGG
ATCTAGGAGGCATGACTTAAAAGATGAACAAACAAGGATTATAAGAGATTCCAAGACTGAGAATTTAAGCTTGAAGAAAGAATACCAAAATAGTAAAATA
TTCCTAAATGTCTTACAGTCTCTCCCTTATAAGTGTGGTGTGCTACACACCCCTAAAAGAGATCTACTTTACATTATATTTTAGACTCTAAATTGACCAT
GAAC

chr12 93,001,116 C C T
AAACCTCAAAAACCCTTCGA
GTTAGGTTAAGGGGGCGGTC
20
20
20
60.11
115
TATTGGATGATTTTATGTGATTCCAAGTTAAGGATTGACATTGGTGAGCATTTATTTAAGATGGCCTCATTTGGTATTTTGATGATTTCATTGGTACGAG
ATGTGCTTTATAAGTGGTTTGCTCTAAAGTTATACACATGTCCACTATTTTCATCAATTTCTACAAACCAGGGTTGAACTCCAATTTTTTTACAAGAATT
TGGTTCTATTTATTTTATGAGGTTATAAGTAGTAACTTCAAGTATAGAATGTAATAACTTACTTGTAAGGATTAAAAACCTCAAAAACCCTTCGAAAAC[
C/T]ACAAAGCTCCTGTCATGAATCGAACAAGGGCCTGGCCGTGATGGGTATCTTAAGTCCACCATGAACCGGAGACCGCCCCCTTAACCTAACATCAAA
ATAACAATAATAATAATAATAAAACTAATAATGCGGAAGCCAATTAAATAGTAATAAATGATGAATCGATAACTCTATGAAAACTAAGAGTCAATCAATA
ACCAACCAACACACATATGTCCACAAAAGCCTCTAAACCATAATAATATCTAAGTTGGGACATGCCCCCAACCATGACCAAAAAGAATAAAAAAGTATTG
CACC

chr12 96,002,701 C T C
CAGACTCTCAGGGATCACAAGT
GGGTCTGGGCCAGTTTCTTA
22
20
22
59.3
149
TCCAAGATAGACCTCAGATTAGGCTATCATCAGCTTAGAGTTAGGGAATGTGACATTTTGAAGACAACTTTCCGTACTCGGTATGGTCTCTTCGAATTTT
TCGTCATGTCATTTGGTTATACCAATGCCCCTGCAGCTTTTATAGACTAGATAAACTGTGTGTTCCAGCAGTACTTGGACATGTTTTTCATAGTCTTTAT
AGATGTTATTCTGGTCTATTCTCGCATAGAGCGTGATCATGCAGACCATCTTAGGATTATTCATCAGACTCTCAGGGATCACAAGTTATTCACTAAGTT[
C/T]AGCAAGTGAAATTTTTGCTAAGATCAATAGCATTCCTTGACCATATTATTTTTGGTGATGGCATTAGAGTAGATCCTCAGAAAACCAACGCTATAA
GAAACTGGCCCAGACCCGTATCTCCATCAGATATTAGAAGTTTCTTGGATTTCGCTGGCATTAAAGATGGTTTATTGACGGATTTTCTTCTATTTCATCT
CCCATGTCCAGATTGACTTAAAAGAAGATTAAGTTTCAGTGGTCAGATTCATGCGAGAAGAGCATTCAAGAGTTGAAGACTCGACTCACCTCAGCTCCTA
TTCT

chr12 101,503,632 T T C
CTCACCAGGAGCCGTAAGAC
ACTCATCCTGCCCAGTTTGT
20
20
20
59.23
147
TATGAGCCGTATGATGGGGTATGAATGGTATGGTCCAGTTGTATGCTGACCAGTGTAGGTTGGTGAGATGGATTTTGGTCACTAGAATGGGTATGGCTTG
GTGGTACGATTCGTATGGTTGGATACAGATCATTTGGTTCCTTCACTCAACCTTAGACTTGGTAAATGAAGTTAGATCTGAGTATGAGTAACTCACCAGG
AGCCGTAAGACCGGGTACAAGTCATACTCAAGACTTGTATGGTGGTCAGTGTTCAAACCTTCTGTGATTCTATCTTGACAGAGATACGGGTGAAGGGTA[
T/C]GGATCATATGTTGTCAAAACAAACTGGGCAGGATGAGTCATACACTGGACAGTGTTGGGTCCAAGGGTTGAGGATTAGGATACGAGTGGTAGGTAC
CAGTCGTATCGAAGGGTACGACTCATGAGGGTCAATCGTACCCTTGTGGTAGGATTTTTTTGCAACTTAAGTGGAGGTATTCTAGAAAATTCCCCACTTA
CCCTAAAAAGGTCCCATGAATTTTAACTATTTTGGGAGGCTATTTACCTTATTATTATATTCACTAACACATAGAAACTCTTCCTAAACACTCTATAATT
CTCT

chr12 107,010,618 G G A
AGGAAATGAGGGGTTTGTGGT
TCTCATGTGCCTTTAACTGCCT
21
22
21
59.96
116
TTGTGGTAGTTAAGAAGTAGCCTAGACCCATGACTCCAATCGATATTTGAAGCTTTTTAGGTTTGGCTGGGTACTATATGAGGTTTGTGGAGTGTTTTTT
GGTGATAAATTCTCCATTGACTAAGTTGACTCAGAAGAAGGTAAATTTCTCTTAGTCAAATGCTTGTGAGGGTAGTTTTGAGAAGTTGAAGGATAAGCTA
ACTTTGACTCTAATTTTGACTTTTCTAGAAGGAAATGAGGGGTTTGTGGTTTATTGTGATTCATTCCGAGTAAGACTTGGTTGTGTCCTAATGTAGCAT[
G/A]GTAAGGTGATAGCCTATGCTTTTAGGCAGTTAAAGGCACATGAGAGGAACTATCCTACTCATGTTTTAGAGCTCGTAGCAGTGGTATTTACGTTGA
AAATATGGCGGCACTATTTATATAGAGTGCACGTTGACAATCTATTCTGCATATTAGAGTCTACAGTATGTGTTCACTCAAAAAGAGAGTAACTCAGGCA
GAGAAGATGGCTTGAGCTTCACAAGAACTATGATGTGAGTCTTTACTACCATCTAGGTAAGGCTAATGTTGTTGCTGATGCTCTTAGCAGGTTGTCTATA
GGGA

chr12 142,500,027 C T C
ACTGATTGTACTTGGCCTGCT
TCAATGTTTATTACCTGGCTTGCT
21
24
21
58.98
81
AGCCATTTTGATGTGAAAGATCTTGGTGAGGCAAATTATATTTTAGGAATAAAAATTACTAGAACATATGATGGAATTTTCCTTGACCAGTCGCATTATG
TTGAGAAAATTTTTAAAAAATATAATTTCCTTGATTTTAAGCATGTTGTAATTCCTTTTGATTCTAATGTTCACTTGTTTCTAGTTGAAAGTGAAAATGA
TGTAATAAAACAAAAGGAATATGCTAGCATAATTGAAAGTTTGAGATATGTGACTGATTGTACTTGGCCTGCTATTGCATATGCAGTAGGAGTACTTAG[
C/T]AGGTTTACAAGCAAGCCAGGTAATAAACATTGACATGTTATAACGAGAGTAATGAGATATTTAATTGAAATAAAAAATTATGGTTTGTTCTGTTAA
AAAAATCTTGATGTACTTGAAGACTTTTGTGATACGGATTGGAACACTTTATCAGGTGATTCCTTATCTACTACTGGTTATATTTTTTATTTTGGGTGGT
GGTGCTATTTGTTGGAAGTCTAAAAGTCAAACTATAATTGCTAACTCTACCATGAAATCTGAACTAATTGCTTTAGCTTCAGCTAGTGAGGAAGCGAATT
GGTT

chr12 143,023,986 C T C
CGCATAGTCCTCGGCTGAAT
AGGTTTGCCTCGTACTTGCT
20
20
20
59.6
115
CAATTACACACGCTCTCAACATATCCTCAAGGATCTGAATGGTCTTCTCTGCCTGACCATCTGTCTGAAGATAGAAAGCTGTACTGAGGTGAACTTCAGT
ACCAAGACCTTTCTGAAAAGCTCTCCAAAAGTAAGAGGTAAATTGAGTACCTCTATCTGAAATGATAGACAATAGAACACCACGCATCCTAACAACTCTC
TGAGATAGAGCTTCGCATAGTCCTCGGCTGAATAGAAAGTATGGACTGACAAGAAATAGGTTGATTTGGTCATCCTATCCACAATGACCTAAATAGAAT[
C/T]AGGCTACTAGCAAGTACGAGGCAAACCTATCACAAAATCCTTGTTCACTTCCTCCCACTTCTAAGTGGGAATACTGAATTCTTGCATGGACCCACT
AGGCTTCTGATGTTTAATCTTAACTTGCTGACACGTGGAGCACTTAGCCACAAACTCTGCAATATCCCTTTTCATCCCACTCCACCAATAGATTTCCCAC
AGATTATGATACAACTTCATGGCCTCTAATGAATCGAGTAACGCGCACCATATGCTTTTGCAAGAATTCATTGTCTCAACTCATCAATACACGGCACACA
CAAT

chr12 179,500,897 C T C
ACACCCAGCCGAATTTACAA
CAGATTAGTTCAGATCCATACGCA
20
24
20
58.47
112
CCACTGAACAATCTATTGCTTTGAATGTAGACAAACAAACCATAAAATTACTGAATAAAAAAGATATTGATATATTTAAAAATCAGTCTAATTTTATGCA
TATTGGTTTAGTGCAAATTACTTTTAAACCTTTAACCTTGAAAGGCCTTCCAGAAATATTTCTAGCTGCACTACGGGATGCTAGAAATCTAAATTTCAGA
CAGTCTTTAATGGGATCTATTGAATCTACTCTTGCTTATAGCCCTGTGTAATTTAACACCCAGCCGAATTTACAATTATCTTTGACTGACATAAATATT[
C/T]TTGATCCTTTGACTTTAAATGTAAAAATCCATGGTTATAATTATGCGTATGGATCTGAACTAATCTGTTTATCCTATCACATTTATTATCGTTTGT
TAGCTACAATGAATCCTCGATGTAAATTGATTGATGATGCCTCTGATTATACTATGCTAATTGAAATAAATTTTGCAAAATTCAAGGTCACTACAAAGAG
ACCTATAAGATAGGATGAGATCAATTTTCCAAAAACATGGATTTTAAGCTCGGTTATTTCTCCAAAACAACTTGCAGAAGATGTGACAAACTCTGAGTTA
ACTC

chr12 199,000,087 C T C
GGTGATCCAATTTGCATCGCT
ACAAAACTCATTGGTTGGCGA
21
21
21
58.97
125
TCCGAAATAACCGAATCGAATTTGTAAAAACCGAACCAAACCGAATTTATTTCGGTTTGATTATGAATGTCATTTTTGTCAATCCGAAAATCGATAAACC
GATAAATCGAATCGATATTAAATAATCAAACCGAACCGACCGAATGCCCACCCCTACCTCCACCGATAGTAAATACATATTCATTCATGGATTTTACTTC
ATTCGATCAGGTGATCCAATTTGCATCGCTATATCCTTCAAGTACCACGGGATATTTATTGTAATGCAAAGCATAGTCTTGAGTGTATTTGAGATACCC[
C/T]AAAACTCTTTTCATCGCCAACCAATGAGTTTTGTTGGGATTACTCGTGTACCGACTTAACTTACTAATAGAGCAAGTTATGTCTGATCGTGTACAA
TTCATTATATACATTAGACATCTCAATACTCTTGCATACTCCAATTGTGAGTCACTTTCACCTTCATTCTTTCGAAGTGCAAAGCTCACATCCAATGGAG
TCTTGGCAATACCGAAGTCCATATACTTGAATTCGTCAAGTACCTTTTCAATATAATGAGACTTTTACAATGCCAATCCTTGTAGAGTTCTATGGATTCT
TATC

chr12 224,500,117 G G A
GCCTACCATGGCGTAGAAAA
GGCTCCACGACTTGCTAAGT
20
20
20
60.04
142
TTATCATATAACCCTTTTTTTCTTTGAAAATCTCAAAATGACATATAGTCGCTAGTTACCAGATGTGTATTGTGTAAATTTACTCATGTATAATGTAACA
TCTCGTATTTCCCTAGCATAATCTAAGTTACAGTACATGAGTATTCATATATAAAATTTTTGAAACACTCATTATTTTTTAGTTTAGAGCCTACCATGGC
GTAGAAAATTCAATTAGCTTTCCAACGATACAAAATTCGCCCAAATTCGATAATCGAGTAAGAAGTTATGACGATTTTAAGTTTCAATCGTTAAACATT[
G/A]TCATTTTGACACTTAGCAAGTCGTGGAGCCAGTGTAAATAGAAATTGTCATTTTTCAGTGTGGGTCCGCAATTATGGTGCGTCGCGCCATAGGCTC
AGTTCAGAACTGTCAATTTTCAGTGAACCTACGCGATACTACCGCATCGCGGTGGGCTTCCAAGTCGCAAACAAGGTGGCAACACAATTTCACCGCATCA
TGCCATCGTGCATTTTCTTAATTGTCCTATTCCAGTGACACGATGTGATAGCGCCGCGTTGTACCAGCCCAGGAAATTGAGATTTTCAGTCAGTTCTGAG
TTTT

chr12 231,501,611 A G A
CTTCTTTCTTGTTTTCAACATCCA
TGATGGAAATATGTGGTCTGAA
24
22
24
55.15
127
CCAACTGACTCGAATAGAAATAGAAATAAATATACAACAATGATAATCTGAATACTTAGTCCTCGAACTAGGAGGACTCACCAGCTGCAGGAATATAGGA
TCAAAGTACTCGGATATCACTGACGTCGCTGAGACTGAGCACCTGAACCTACATATAGGAAATGTAGCCCNAGCTGGAATAAAATCATCAAGATTATGGA
TAAGTAAATCATATATCACAAACACGTGAGTCATTTCAATAATTTCATAAATTCACTTCTTTCTTGTTTTCAACATCCATAATAATCGAACTTCAGGAT[
A/G]ATTTCCTTTTTGGAATATACATCTCAATCTTTAATAATATCAACTTTCTCAAACAATTATTTCAGACCACATATTTCCATCATATATATAGAATAG
AGACACACGCACACAGTGGAAGATCTTATAACCAACACAAACCATGTGAGCTACATGGAGTCCAACGTCTAACCCACATTGGGGCGAGCTGTCCTATCCT
TGCCATCGGAGTAGGACCTTAATTCATCAACTTCAAACACTAGTGATCAGTATATAAATCATCCTCAATTTCGGCTCCTACGGGGGCACGTAGTTCTAGG
AAAG





Contact Us : help@seeders.co.kr +82 042-710-4025
TGsol is supported by the Next-Generation BioGreen 21 Program, RDA, Republic of Korea.

SEEDERS Inc. is specialized in Agri-Bioinformatics
Republic of Korea, Daejeon, 34015
www.seeders.co.kr
logout